All posts copyright Rosa Rubicondior. Contents may be reproduced without permission provided credit is given to the author, it is not altered in any way, the context is made clear and a link is provided to the original.

Hopefully religious and other offensive advertising content has now been blocked from this site. Please let me know if you see any.

Friday, 30 December 2011

What A Pain: Does God Hate Everything?

So what's the purpose of pain?

In the UK, The National Health Service spent £442,000,000 on pain killers alone last year.  In the USA the analgesics market is said to be worth $2,800,000,000, that's $2.8 billion, per annum.

Clearly, pain is seen as a major medical problem and something to be overcome, even at considerable expense. Most people can imagine few things more distressing than constant chronic pain.

How many times have you heard piously self-righteous Christians and Muslims gleefully telling those who disagree with them that they can expect an eternity of pain and suffering for doing so?  Suffering eternal pain seems to be the worst thing at least some humans can imagine.

There seems to be nothing to be said for pain at all. Yet we even have specialised nerve endings for feeling pain and centres in our brains for processing the information they provide and turning this into the conscious unpleasant experience we call pain. Indeed, the normal responses of our bodies to injury often seem designed to INCREASE the pain of injury.

So why have we evolved the ability to feel pain?

Put simply, pain tells us something is wrong. Pain draws our attention to injury or disease. Pain says do something or don't do something; guard me, rest me or don't use me. Don't walk on that broken ankle because it needs to be rested. Don't carry on with that chest pain but slow down and take a rest. Don't bite on that tooth or raise that broken arm. Close your eyes and sleep when that headache becomes unbearable. Put your hand over your ear when cold wind makes it ache and change your shoes when that blister bursts...

Pain even initiates reflexes which happen before our brains have noticed.  These spinal reflexes have evolved to protect various parts of our bodies and pain is the signal to act automatically without the normal luxury of thinking about it first.

Pain has evolved as a signal. It is unpleasant because that tells us to try to stop it by resting or guarding the hurting part of our body. Pain is unpleasant because we have evolved to REGARD it as unpleasant. Being unpleasant means we do something about it to reduce the unpleasant sensation.

Consider a patient dying in extreme pain of cancer, or an abscess, or a disabling injury in the absence of any pain relief? What possible purpose could that serve the individual?


Consider a gazelle dying of the shock of having it's intestines pulled out and its liver eaten by lions whilst still alive, or the zebra having a leg torn off by a crocodile as it is slowly drowned.

How does pain server these individual?

Nature is unemotional and entirely lacking in compassion. Nature doesn't care about the suffering of a prey species as it is eaten and yet we can be quite sure that every sentient creature, and probably many others, feel pain. Nature has no concern at all for the discomfort or distress of an animal suffering from infection or dying of disease or simply starving to death of old age.

The fate of almost every living multi-cellular thing is to die of disease, or by being eaten, or of starvation due to injury or old age. There are very many ways to die and none of them are pleasant.

And millions of feeling animals die every day in great pain. A system which has evolved to keep you alive is useless when you are dying, and yet it is still demanding you do something even when there is nothing you can do.

So why should we have evolved something we don't like and why would it be at its most insistent when at its most useless?  What intelligent designer would design such a thing?

Because evolution isn't driven by what we like or dislike; evolution is driven by whatever ensures we have more descendants than we would otherwise have. Evolution is determined by what is in the interests of our genes because it is our genes which either survive in the next generation, or don't.  And there is no benefit to our genes in evolving a mechanism to turn it off when it is no longer any use.

So, evolution has provided us with something we don't like, and this is perfectly understandable in terms of mindless, unemotional, uncaring, genetic evolution.

What is NOT understandable is how this could have been designed by an intelligent, loving, caring and compassionate god. If pain has been designed by a god then that god must be a stupid, cruel, sadistic and hateful god. (Tweet this)

Thursday, 29 December 2011

Jesus - History or Hoax?

This blog is derived from a Tweetlonger tweet by @dawkinsassange in reply to @tndan who cited "Christianity: HOAX OR HISTORY" by Josh McDowell as 'proof' of the historicity of Jesus.

I reproduce it here as a refutation of that book and of the many fallacious and inaccurate claims contained in it.

My thanks to @dawkinsassange for permission to reproduce it.







Pgs. 38-39 Appeal to Authority fallacy. Answered in this link.

Pgs. 40-41 No contemporary evidence of Apostles (earliest 150 AD)

Pgs. 41-44 Guilt by association fallacy & faulty analogy. The Watergate conspirators were not being promised eternal rewards in heaven. If these martyrs existed, I have no doubt they BELIEVED, which is irrelevant to actual events.

Pgs. 45-46 Appeal to Authority fallacy

Pg. 47 "Strong evidence that the NT written at an early date" not supported in text. Only assertions.

Pg. 48 "Oral tradition not long enough.." Proof? Evidence?

Pgs. 49-51 So there's no originals. Therefore unknown numbers of errors.

Pgs. 52-54 Much of the NT was admitted to be hearsay. The writer of Mark's confusion with Palestinian geography is circumstantial evidence that Mark wasn't there.

Pgs. 54-55 The contradictions between NT writers indicate lies.

Pgs. 55-58 An alternative explanation that doesn't include miracles is that it is all legendary.

Pgs. 58-59 Writers a hundred years after the event don't add a lot to historicity. In fact, there were many contemporary writers who never attested to Jesus.

Pgs. 59-60 Luke doesn't agree with Josephus.

Pg. 60 "One test of a writer is consistency" Agreed. Luke fails.

Pgs. 61-62 The same standard must be set to the Bible as other secular literature. No. Extraordinary claims require extraordinary proof. Otherwise it must be treated the same as other ancient records of legends such as Hercules.

Pgs. 62-63 Criterion of embarrassment argument. Limited in application and not proof that the event happened as described. May be used to fit writer's theology.

Pgs. 65-69 I felt the same joy when released from indoctrination.

Pgs. 73-79 Preaching and selling stuff.

Pgs. 81-83 Disagree. Bible is consistent only in it's inconsistency. It shows every indication of being written by ancient superstitious people.

Podcasts by Peter Coote (@cootey59) also dealing with this may be heard here.

Hoax or History? I vote Hoax

[Yet to be added: Josh McDowell's reply.]

Tuesday, 27 December 2011

The Depths To Which Christians Will Go...

Antony Garrard Newton Flew
(11 February 1923 – 8 April 2010)
Antony Flew Considers God...Sort Of:


An exposé of the claim that Anthony Flew recanted his Atheism and converted to Christianity, by Richard Carrier

Worth the long read to see the depths Christian apologists will go to to keep their market intact and their income stream flowing.

My thanks to @jablomih on Twitter for providing me with the link. In his words, "Can you imagine atheists circling William Lane Craig's deathbed looking for a "conversion"? Or lying & saying he had one?"

Saturday, 24 December 2011

Are The Bible's Publishers Breaking The Law?

In England we have the Serious Crimes Act 2007 Part 2 of which came into force in 2008. Section 59 removed the Common Law offence of incitement and replaced it with the criminal offence of Encouraging or Assisting Crime defined as:

Section 44. Intentionally encouraging or assisting an offence.

Section 45. Encouraging or assisting an offence believing it will be committed.

Section 46. Encouraging or assisting offences believing one or more will be committed.

It would be astonishing if other civilized countries didn't have similar laws.

So what has this to do with the Bible?

Leviticus 20:

9 For every one that curseth his father or his mother shall be surely put to death: he hath cursed his father or his mother; his blood shall be upon him.

Incitement to commit murder.

10 And the man that committeth adultery with another man's wife, even he that committeth adultery with his neighbour's wife, the adulterer and the adulteress shall surely be put to death.

Ditto

11 And the man that lieth with his father's wife hath uncovered his father's nakedness: both of them shall surely be put to death; their blood shall be upon them.

Ditto

12 And if a man lie with his daughter in law, both of them shall surely be put to death: they have wrought confusion; their blood shall be upon them.

Ditto

13 If a man also lie with mankind, as he lieth with a woman, both of them have committed an abomination: they shall surely be put to death; their blood shall be upon them.

Ditto

14 And if a man take a wife and her mother, it is wickedness: they shall be burnt with fire, both he and they; that there be no wickedness among you.

Ditto

Also in England we have the Racial and Religious Hatred Act 2007.  This created the criminal offence of inciting hatred against a person on the grounds of their religion by "A person who uses threatening words or behaviour, or displays any written material which is threatening... if he intends thereby to stir up religious hatred"

Hmm...

Deuteronomy 13:6-10 "If thy brother, the son of thy mother, or thy son, or thy daughter, or the wife of thy bosom, or thy friend, which is as thine own soul, entice thee secretly, saying, Let us go and serve other gods, which thou hast not known, thou, nor thy fathers; Namely, of the gods of the people which are round about you, nigh unto thee, or far off from thee, from the one end of the earth even unto the other end of the earth; Thou shalt not consent unto him, nor hearken unto him; neither shall thine eye pity him, neither shalt thou spare, neither shalt thou conceal him: But thou shalt surely kill him; thine hand shall be first upon him to put him to death, and afterwards the hand of all the people. And thou shalt stone him with stones, that he die..."

Religious intolerance and hatred AND incitement to commit murder.

2 Chronicles 19:2 "And Jehu the son of Hanani the seer went out to meet him, and said to king Jehoshaphat, Shouldest thou help the ungodly, and love them that hate the LORD? therefore is wrath upon thee from before the LORD.

Incitement to religious hatred.

Psalm 139 19-22: Surely thou wilt slay the wicked, O God: depart from me therefore, ye bloody men. For they speak against thee wickedly, and thine enemies take thy name in vain. Do not I hate them, O LORD, that hate thee? and am not I grieved with those that rise up against thee? I hate them with perfect hatred: I count them mine enemies.

Ditto


Luke 19:27 (Quoting Jesus) "But those mine enemies, which would not that I should reign over them, bring hither, and slay them before me."

Incitement to religious intolerance and incitement to commit murder.

Galatians 1:9 "As we said before, so say I now again, if any man preach any other gospel unto you than that ye have received, let him be accursed."

Incitement to religious intolerance.

And so on.

We could do the same with Disability Discrimination, with Human Rights laws, with Equal Opportunities legislation.

So why is it that an organisation which daily promotes criminality and incitement to crime is not only allowed to get away with it, but, when it demands the right to have a say in our legislature and to be consulted about all matters of morality and ethics, is listened to and given a power to meddle far in excess of its support in many civilised countries?

Would we give even a second's thought to such a demand from any other criminal organisation? (Tweet this)

Thursday, 22 December 2011

Foolish Jesus And The Ravening Wolves

Browsing casually through the KJV Bible today, I came across these curious passages.

According to Matthew, Jesus tells a tale about a wise man building his house on rock and a foolish man building it on sand. He then prophesies that a house built on rock won't fall down but one built on sand will.

Matthew 7:22-27
Therefore whosoever heareth these sayings of mine, and doeth them, I will liken him unto a wise man, which built his house upon a rock: And the rain descended, and the floods came, and the winds blew, and beat upon that house; and it fell not: for it was founded upon a rock.

And every one that heareth these sayings of mine, and doeth them not, shall be likened unto a foolish man, which built his house upon the sand: And the rain descended, and the floods came, and the winds blew, and beat upon that house; and it fell: and great was the fall of it.
Well, that's pretty obvious really. It doesn't take a genius to come to come up with that, does it.

But what's this a little later on?

Matthew then tells us this curious tale:

Matthew 16:16-18
And Simon Peter answered and said, Thou art the Christ, the Son of the living God. And Jesus answered and said unto him, Blessed art thou, Simon Barjona: for flesh and blood hath not revealed it unto thee, but my Father which is in heaven. And I say also unto thee, That thou art Peter, and upon this rock I will build my church; and the gates of hell shall not prevail against it.
Hmm... so Matthew has Jesus choosing Simon Barjona as the rock upon which to build his church. Note the use of the singular there; "my church", not "my churches". He also has Jesus prophesying that "the gates of hell shall not prevail against it". Again the singular 'it'.

But what happened to this church? How did that prophesy turn out?

Is there just one true church? Clearly not. Apart from the major schisms between the Roman and Orthodox Church, there are also the earlier schisms between the Coptic, Armenian and Maronite Christian churches, the Cathars, the Paulicians, Lollards, Hussites, etc. Then of course the various other schisms like that between the Catholic and Protestant churches.

And then the storm really hit. The Protestant church almost immediately fragmented into all the various sects like Lutherans, Calvinists, Quakers, Presbyterian, Baptist, Anabaptist, Seventh Day Adventist, Methodist, Anglican or Episcopalian, etc, etc, etc, and the Baptist sect alone promptly shattered again into a myriad different churches so that today we have some 38,000 different churches, all claiming to be the one true church and, at least by implication, that all the others are false, and therefore Satanic.
Ravening Wolf

The One True Church Jesus built on Simon 'The Rock' Barjona has shattered like grains of sand, and the gates of hell seem to have prevailed against it, if you believe all the present churches, that is.

Curious how all these modern-day priests seem to want their 'flock' to believe that Jesus was a foolish man, a false prophet and a poor judge of character in his choice of Simon, and that the Gates of Hell have indeed triumphed over Jesus' church, eh?

Or was Matthew up to something when he made up those tales?

What's that you say, Matthew?
Beware of false prophets, which come to you in sheep's clothing, but inwardly they are ravening wolves (Matthew 7:15)
Hmm... so beware of Jesus, the ravening wolf clothed as a lamb, eh?

Blimey! Subversive, or what!? You'd have thought the Bible's editors would have picked that one up.

I'm glad I'm not a Christian so I don't have to work out ways to ignore this sort of hopeless muddle.

Wednesday, 21 December 2011

Talking Turkey

I heard an interesting thing today. At least I find it interesting.

Apparently, in the fifteenth century, Turkish traders started supplying England with the helmeted guinea fowl (Numida meleagris), a bird found wild in East Africa which had been domesticated there for about 4000 years and was so named because of the strange bony structure it has on its head. It had been introduced by the Romans 1400 years earlier, but had been lost with the collapse of the Roman Empire.

These traders were know as Turkish or Turkey Traders and, by the sort of popular misunderstanding which helps create new words in a language, these birds became popularly known as turkeys. They were a popular meat at Christmas because they tasted good and had a fair amount of meat on them.


Later, when the distantly related wild bird now know as the turkey (Meleagris gallopavo), was introduced from the New World, because it looked and tasted a bit like the 'turkey' it was mistakenly also called a turkey. As the helmeted guinea fowl fell out of favour, the name transferred to the New World bird.


So, a New World bird came to be known indirectly by the same name as a country with which it had absolutely no direct connection.


Have a Cool Yule.

Tuesday, 20 December 2011

Evolution - The Meaning of Information


Go to any creationist website and you will find any number of 'creation scientist' explaining to their credulous and gullible readership and potential customers that information theory proves that no new information can arise by a random process, or some such half-baked notion, so the Theory of Evolution must be wrong (so a magic man magicked everything and it must have been the locally popular one, obviously, as eny fule kno).

Where do they get these ideas from?

Mutations in DNA are relatively common because the copying process is not perfect, despite the mechanisms which have evolved to correct them.

I'll not go into the so-called genetic code here because, with a few clicks on Google, or by opening any of very many books on the subject, this can be easily found by those who wish to know more. Those who don't won't have bothered reading this far.

If anyone can tell me why a mutation which changes the genetic code for a small portion of a given enzyme from, let's say, UUAUAUCAUGUAGAUAACCCCUGA to UUAUCUCAUGUAGAUAACCCCUGA in the short sequence of mRNA, is prohibited by the second law of thermodynamics, I'd be very grateful...


Of course, there is no reason at all why this should be impossible; a proposition which is rendered even more absurd by the observable fact that it happens. There should be a clue here for creationists. Hint: impossible things don't happen; things that happen are not impossible. (I appreciate the logic there might need more than a few moments thought for the average creationist.)

So, what would this mutation do? In case you didn't notice, the second group of three letters has changed from UAU to UCU. In terms of the genetic code, this will mean the resulting protein will have the amino acid serine in place of tyrosine.

The answer of course depends on what the protein does. If it's an enzyme, the chances are that, unless this section is from the functional part of the enzyme, it will have little or no effect at all.

So what new information has arisen by this mutation? Unless you regard changed information as new information, there IS no new information. The information still tells a cell how to build the enzyme.

But what MIGHT have changed is the meaning of the information, and, just as with written language, the meaning of the information written down depends entirely on the environmental context. Written language only has meaning in the context of an environment in which literate speakers of the language exist. Otherwise, it has no more meaning than random marks on paper.

I'll illustrate this with a hypothetical, but possible, scenario:

In recent history, humans learned to harvest the natural sap of the rubber tree and use it as a material. A little latter, we learned to process this latex chemically by a process called vulcanisation which makes a much stronger substance suitable for making things like car tyres. Now millions of tons of vulcanized rubber are deposited on our roads and washed off into waterways or blown as dust into surrounding countryside to be incorporated into the soil.

Now, rubber is a natural substance, even in it's vulcanized form, so in theory is should be possible for a bacterium to evolve the ability to process all this rubber in the environment. Maybe if only for the sake of road safety, we are fortunate that none has yet done so, so far as we know.

But, what if a mutation such as I mentioned above were to change an enzyme in such a way that made this possible? What if this small change in information, in the context of all this man-made vulcanized rubber, gave a bacterium a new source of energy?

What an advantage that would give it compared to forms carrying the non-mutated gene!

But what if this mutation had arisen, say, 500 years ago? It would, of course, have been completely meaningless and would have conveyed no advantage whatsoever until recently. A mutation only has meaning in the context of the environment in which it arises. Out of that context it has no meaning at all.

It is the MEANING of the information which changes and THAT depends on the environment.

Sunday, 18 December 2011

If God Wants Us To Believe In Him

If the Judeo-Christian god want us to believe in him, why doesn't he:

1. Do to each of us what he allegedly did to Saul on the road to Damascus?

2. Become incarnate and perform public miracles at every generation, as he allegedly did to Moses and as Jesus?

3. Spontaneously appear and end a famine, stop a war, cure a disease or prevent a natural disaster.


Why didn't he:

1. Create a universe, solar system and life on earth in such a way that it is totally unexplainable by science, and leaving him as the only possible explanation above all other possible gods?

2. Create life on earth so that it cannot be explain by ideas of common descent and divergence; so that comparative anatomy and physiology can find no connections or similarities between different species; that there are no classes intermediate between fish and mammals, or similarities between humans and other life forms; that each species had an entirely different genetic code, or no code at all; with no fossil evidence suggesting an evolutionary process with regular extinctions?

3. Create a flat earth so it could not be logically explained any other way than by divine creation?

4. Create an earth with no geological evidence suggesting it is very old and has formed by a dynamic process over a very long time?

5. Created an earth with no evidence of unintelligent design?

6. Created a monument to Abraham which could be accurately dated?

7. Arranged for there to be archaeological and independent historical evidence of the Exodus, the wandering of the Israelites in Sinai, the destruction of the Canaanites, the massive economic collapse of Egypt following the plagues and the loss of it's slave population, etc?

8. Left unarguable evidence of a universal flood and made remains of Noah's Ark easy to find and validate?

Why doesn't he:

1. Make Christians nicer people who actually do what they tell others they should do?

2. Answer prayers in ways too obvious to be disputed, making Christians people we can go to to get our problems sorted by prayer?

3. Produce evidence that prayer works so that scientific studies would always show overwhelming evidence of their efficacy?

4. Create a single, world-wide religion?

5. Predict future events precisely so that we can see clearly the validity of the prediction?

6. Create a religion which, unlike all other known religions, is not disbelieved by a majority of the world's people?

In short, why doesn't the Judeo-Christian god seem to want people to believe in him? (Tweet this)

For more on this, see John W. Loftus, "Why I Became An Atheist"

Oops! Another Bible Blunder

Jeremiah 7: 21-23 Thus saith the LORD of hosts, the God of Israel; Put your burnt offerings unto your sacrifices, and eat flesh. For I spake not unto your fathers, nor commanded them in the day that I brought them out of the land of Egypt, concerning burnt offerings or sacrifices: But this thing commanded I them, saying, Obey my voice, and I will be your God, and ye shall be my people: and walk ye in all the ways that I have commanded you, that it may be well unto you.


Leviticus 1:1-9 And the LORD called unto Moses, and spake unto him out of the tabernacle of the congregation, saying, Speak unto the children of Israel, and say unto them, If any man of you bring an offering unto the LORD, ye shall bring your offering of the cattle, even of the herd, and of the flock. If his offering be a burnt sacrifice of the herd, let him offer a male without blemish: he shall offer it of his own voluntary will at the door of the tabernacle of the congregation before the LORD. And he shall put his hand upon the head of the burnt offering; and it shall be accepted for him to make atonement for him. And he shall kill the bullock before the LORD: and the priests, Aaron's sons, shall bring the blood, and sprinkle the blood round about upon the altar that is by the door of the tabernacle of the congregation. And he shall flay the burnt offering, and cut it into his pieces. And the sons of Aaron the priest shall put fire upon the altar, and lay the wood in order upon the fire: And the priests, Aaron's sons, shall lay the parts, the head, and the fat, in order upon the wood that is on the fire which is upon the altar: But his inwards and his legs shall he wash in water: and the priest shall burn all on the altar, to be a burnt sacrifice, an offering made by fire, of a sweet savour unto the LORD.

So which of these is the truth? Is the account in Leviticus 1 of God talking to Moses concerning burnt offerings, correct, or is Jeremiah right to say that God did NOT give any such command?

Or are we expected to just believe two mutually contradictory things simultaneously in order to believe that the Bible is the word of a god, and not a poorly edited and inconsistent collection of various writings of different people following different agenda at different times?

Saturday, 17 December 2011

Ten Commandments - Tory Version

1. Thou shalt have no other god but money.

2. Thou shalt not make any graven image save what thou canst sell for profit and dividend for thine bankers and money-lenders.

3. Thou shalt serve the money-lenders and bankers for we are a greedy class and shall visit iniquity unto thee and thine children even unto the fourth generation if thou bowest not down before us, but we shall smile upon those who slip a bung into party funds (see the LORD Ashcroft of Belize if thou requirest anonimity)

4. Forgeth thou the Sabbath day for we can make more then than on most normal shopping days, and if the shop workers liketh it not, they canst joineth the other scum in the jobless scrap heap even unto the rest of their days, for they wanteth a day of rest and it shall be given...

5. Thou shalt not kill, save when using the bombs and bullets made by those who doth bung a wad into our bank account, yea, even through the Belize Slush Facility.

6. Thou shalt not commit adultery unless thou hast already fixed up a 'kiss and tell' deal with the Sun of Murdoch, or hath taken out an Super Injunction from the Court on High, and especially whilst thou art still in the Cabinet and doth lecture the common masses on morality and values of the family, lest they laugh at thee and call thee hypocrite.

7. Thou shalt steal only what thou may steal legally, and thou shall support any Law which allowth thou so to do. Remember thou what thou wentest into politics for.

8. Thou shalt not bear false witness against thy neighbour unless thou knowest thou can get away with it. Prepareth thou the ground well before thou dost try and have something on thy neighbour in case he cuts up rough and dobs thou in it too.

9. Thou shalt covet thy neighbours house if he hast a bigger one than thou, and thou shalt borrow more money than thou canst afford to repay from the money-lenders so thou canst have a bigger one.

10. Thou shalt covet thy neighbours wife, especially if she be a trophy, and his servants and his goods and thou shalt feel a failure in life if thou hath less than another man, for thou art indeed beneath comtempt for a man is worth the value of his possessions.

11. Thou shalt hold in comtempt all who labour and toil and especially those who careth for others and toil for the common good, for care and compassion are for softies and only those who have it not work for those who have, for this is the will of thy god.

12. Er.... raneth over there a little.

Friday, 16 December 2011

Impressions of Prague - Jan Palach and Jan Zajíc

In Memory of the Victims of Communism
Wenceslas Square, Prague.
For those of us on the Marxist left in 1968 the "Prague Spring" and it's brutal suppression by a combined force of Eastern Block armies was a culture shock. These were formative years for me.

After the frank embarrassment of the suppression of the Hungarian uprising in 1956 we had looked to Alexander Dubček and the Czechoslavak liberal reformers to deliver us "Communism with a human face".

It occurred against a backdrop of world-wide condemnation of US involvement in Vietnam and the increasing popularity of the French and Italian Communist Parties with what seemed the real prospect of democratically elected Communist governments in two Western European countries and members of the Common Market (as the EU was then known). Student radical groups were becoming influential in France, Germany and Britain. African leaders like Agostinho Neto and Samoral Machel were leading Marxist rebellions in Portugese colonies; even in America student radicals were politicising America's youth. And of course the heroic people of South East Asia were beating back the advance of Western Imperialism and taking their countries back, led, naturally, by good Marxist-Leninists like Ho Chi Minh and the NLF.

The world seemed to be coming over to the next stage in human historical development exactly as Marxist theory told us was inevitable. 'Revolutionary situations' were arising everywhere we looked. The inevitable march of human history was gathering pace and time was on our side.

Then resurrected Stalinism intervened in Prague and put an end to all that.

And a brave young idealist, Jan Palach, burned himself to death in Wenceslas Square, followed a month later by Jan Zajíc, to show us what Communism was to those who lived it in real life.

And the world changed.

Jan Palach set fire to himself on 16 January, 1969 and Jan Zajíc on 25 February the same year.

Never again could we argue that Communism grew out of a love for the common man; that it was an expression of egalitarian democracy.

Suddenly we could see what Communism had become in just 50 years in Russia. It was in many ways indistinguishable from Fascism. The same nationalist imperialists we despised were running the show in the East; no nation had the right of self-determination as free peoples; Eastern Europe and the Eastern European peoples were a lesser people, there to serve the needs of the Soviet Communist Party and it's self-appointed elite. The revolution which was suppose to have put an end to class conflict and the dictatorship of Capital, and to have instigated the Dictatorship of the Proletariat, had given rise instead to a new ruling class and the dictatorship of Bureaucrats.

"The creatures outside looked from pig to man, and from man to pig, and from pig to man again; but already it was impossible to say which was which." - George Orwell, "Animal Farm"

And the student radicals from the East who could make their voice heard were telling us what WE had was what they wanted. That our system was the worst of all systems - apart from all the others.

I'm glad and proud to live in a free Europe in which I can go to Prague and look at the Memorial to the Victims of Communism and say a silent thank you to those two young men who had such a profound effect on me, and on so many others, and who helped make this possible, almost 43 years ago.

Long may it remain so.

[Later note: Sadly, two days after I wrote the above, Vaclav Havel, first president of post-Communist Republica Czeska (The Czech Republic) died. I reproduce in full the 1990 New Year address he gave to the nation:]

‘My dear fellow citizens,

For forty years you heard from my predecessors on this day different variations on the same theme: how our country was flourishing, how many million tons of steel we produced, how happy we all were, how we trusted our government, and what bright perspectives were unfolding in front of us.

I assume you did not propose me for this office so that I, too, would lie to you.

Our country is not flourishing. The enormous creative and spiritual potential of our nations is not being used sensibly. Entire branches of industry are producing goods that are of no interest to anyone, while we are lacking the things we need. A state which calls itself a workers' state humiliates and exploits workers. Our obsolete economy is wasting the little energy we have available. A country that once could be proud of the educational level of its citizens spends so little on education that it ranks today as seventy-second in the world. We have polluted the soil, rivers and forests bequeathed to us by our ancestors, and we have today the most contaminated environment in Europe. Adults in our country die earlier than in most other European countries.

Allow me a small personal observation. When I flew recently to Bratislava, I found some time during discussions to look out of the plane window. I saw the industrial complex of Slovnaft chemical factory and the giant Petr'alka housing estate right behind it. The view was enough for me to understand that for decades our statesmen and political leaders did not look or did not want to look out of the windows of their planes. No study of statistics available to me would enable me to understand faster and better the situation in which we find ourselves.

But all this is still not the main problem. The worst thing is that we live in a contaminated moral environment. We fell morally ill because we became used to saying something different from what we thought. We learned not to believe in anything, to ignore one another, to care only about ourselves. Concepts such as love, friendship, compassion, humility or forgiveness lost their depth and dimension, and for many of us they represented only psychological peculiarities, or they resembled gone-astray greetings from ancient times, a little ridiculous in the era of computers and spaceships. Only a few of us were able to cry out loudly that the powers that be should not be all-powerful and that the special farms, which produced ecologically pure and top-quality food just for them, should send their produce to schools, children's homes and hospitals if our agriculture was unable to offer them to all.

The previous regime — armed with its arrogant and intolerant ideology — reduced man to a force of production, and nature to a tool of production. In this it attacked both their very substance and their mutual relationship. It reduced gifted and autonomous people, skillfully working in their own country, to the nuts and bolts of some monstrously huge, noisy and stinking machine, whose real meaning was not clear to anyone. It could not do more than slowly but inexorably wear out itself and all its nuts and bolts.

When I talk about the contaminated moral atmosphere, I am not talking just about the gentlemen who eat organic vegetables and do not look out of the plane windows. I am talking about all of us. We had all become used to the totalitarian system and accepted it as an unchangeable fact and thus helped to perpetuate it. In other words, we are all — though naturally to differing extents — responsible for the operation of the totalitarian machinery. None of us is just its victim. We are all also its co-creators.

Why do I say this? It would be very unreasonable to understand the sad legacy of the last forty years as something alien, which some distant relative bequeathed to us. On the contrary, we have to accept this legacy as a sin we committed against ourselves. If we accept it as such, we will understand that it is up to us all, and up to us alone to do something about it. We cannot blame the previous rulers for everything, not only because it would be untrue, but also because it would blunt the duty that each of us faces today: namely, the obligation to act independently, freely, reasonably and quickly. Let us not be mistaken: the best government in the world, the best parliament and the best president, cannot achieve much on their own. And it would be wrong to expect a general remedy from them alone. Freedom and democracy include participation and therefore responsibility from us all.

If we realize this, then all the horrors that the new Czechoslovak democracy inherited will cease to appear so terrible. If we realize this, hope will return to our hearts.

In the effort to rectify matters of common concern, we have something to lean on. The recent period — and in particular the last six weeks of our peaceful revolution — has shown the enormous human, moral and spiritual potential, and the civic culture that slumbered in our society under the enforced mask of apathy. Whenever someone categorically claimed that we were this or that, I always objected that society is a very mysterious creature and that it is unwise to trust only the face it presents to you. I am happy that I was not mistaken. Everywhere in the world people wonder where those meek, humiliated, skeptical and seemingly cynical citizens of Czechoslovakia found the marvelous strength to shake the totalitarian yoke from their shoulders in several weeks, and in a decent and peaceful way. And let us ask: Where did the young people who never knew another system get their desire for truth, their love of free thought, their political ideas, their civic courage and civic prudence? How did it happen that their parents — the very generation that had been considered lost — joined them? How is it that so many people immediately knew what to do and none needed any advice or instruction?

I think there are two main reasons for the hopeful face of our present situation. First of all, people are never just a product of the external world; they are also able to relate themselves to something superior, however systematically the external world tries to kill that ability in them. Secondly, the humanistic and democratic traditions, about which there had been so much idle talk, did after all slumber in the unconsciousness of our nations and ethnic minorities, and were inconspicuously passed from one generation to another, so that each of us could discover them at the right time and transform them into deeds.

We had to pay, however, for our present freedom. Many citizens perished in jails in the 1950s, many were executed, thousands of human lives were destroyed, hundreds of thousands of talented people were forced to leave the country. Those who defended the honor of our nations during the Second World War, those who rebelled against totalitarian rule and those who simply managed to remain themselves and think freely, were all persecuted. We should not forget any of those who paid for our present freedom in one way or another. Independent courts should impartially consider the possible guilt of those who were responsible for the persecutions, so that the truth about our recent past might be fully revealed.

We must also bear in mind that other nations have paid even more dearly for their present freedom, and that indirectly they have also paid for ours. The rivers of blood that have flowed in Hungary, Poland, Germany and recently in such a horrific manner in Romania, as well as the sea of blood shed by the nations of the Soviet Union, must not be forgotten. First of all because all human suffering concerns every other human being. But more than this, they must also not be forgotten because it is these great sacrifices that form the tragic background of today's freedom or the gradual emancipation of the nations of the Soviet Bloc, and thus the background of our own newfound freedom. Without the changes in the Soviet Union, Poland, Hungary, and the German Democratic Republic, what has happened in our country would have scarcely happened. And if it did, it certainly would not have followed such a peaceful course.

The fact that we enjoyed optimal international conditions does not mean that anyone else has directly helped us during the recent weeks. In fact, after hundreds of years, both our nations have raised their heads high of their own initiative without relying on the help of stronger nations or powers. It seems to me that this constitutes the great moral asset of the present moment. This moment holds within itself the hope that in the future we will no longer suffer from the complex of those who must always express their gratitude to somebody. It now depends only on us whether this hope will be realized and whether our civic, national, and political self-confidence will be awakened in a historically new way.

Self-confidence is not pride. Just the contrary: only a person or a nation that is self-confident, in the best sense of the word, is capable of listening to others, accepting them as equals, forgiving its enemies and regretting its own guilt. Let us try to introduce this kind of self-confidence into the life of our community and, as nations, into our behavior on the international stage. Only thus can we restore our self-respect and our respect for one another as well as the respect of other nations.

Our state should never again be an appendage or a poor relative of anyone else. It is true that we must accept and learn many things from others, but we must do this in the future as their equal partners, who also have something to offer.

Our first president wrote: “Jesus, not Caesar.” In this he followed our philosophers Chelčický and Komenský. I dare to say that we may even have an opportunity to spread this idea further and introduce a new element into European and global politics. Our country, if that is what we want, can now permanently radiate love, understanding, the power of the spirit and of ideas. It is precisely this glow that we can offer as our specific contribution to international politics.

Masaryk [the first president of Czechoslovakia] based his politics on morality. Let us try, in a new time and in a new way, to restore this concept of politics. Let us teach ourselves and others that politics should be an expression of a desire to contribute to the happiness of the community rather than of a need to cheat or rape the community. Let us teach ourselves and others that politics can be not simply the art of the possible, especially if this means the art of speculation, calculation, intrigue, secret deals and pragmatic maneuvering, but that it can also be the art of the impossible, that is, the art of improving ourselves and the world.

We are a small country, yet at one time we were the spiritual crossroads of Europe. Is there a reason why we could not again become one? Would it not be another asset with which to repay the help of others that we are going to need?

Our homegrown Mafia, those who do not look out of the plane windows and who eat specially fed pigs, may still be around and at times may muddy the waters, but they are no longer our main enemy. Even less so is our main enemy any kind of international Mafia. Our main enemy today is our own bad traits: indifference to the common good, vanity, personal ambition, selfishness, and rivalry. The main struggle will have to be fought on this field.

There are free elections and an election campaign ahead of us. Let us not allow this struggle to dirty the so-far clean face of our gentle revolution. Let us not allow the sympathies of the world, which we have won so fast, to be equally rapidly lost through our becoming entangled in the jungle of skirmishes for power. Let us not allow the desire to serve oneself to bloom once again under the stately garb of the desire to serve the common good. It is not really important now which party, club or group prevails in the elections. The important thing is that the winners will be the best of us, in the moral, civic, political and professional sense, regardless of their political affiliations. The future policies and prestige of our state will depend on the personalities we select, and later, elect to our representative bodies.

My dear fellow citizens!

Three days ago I became the president of the republic as a consequence of your will, expressed through the deputies of the Federal Assembly. You have a right to expect me to mention the tasks I see before me as president.

The first of these is to use all my power and influence to ensure that we soon step up to the ballot boxes in a free election, and that our path toward this historic milestone will be dignified and peaceful.

My second task is to guarantee that we approach these elections as two self-governing nations who respect each other's interests, national identity, religious traditions, and symbols. As a Czech who has given his presidential oath to an important Slovak who is personally close to him, I feel a special obligation -- after the bitter experiences that Slovaks had in the past -- to see that all the interests of the Slovak nation are respected and that no state office, including the highest one, will ever be barred to it in the future.

My third task is to support everything that will lead to better circumstances for our children, the elderly, women, the sick, the hardworking laborers, the national minorities and all citizens who are for any reason worse off than others. High-quality food or hospitals must no longer be a prerogative of the powerful; they must be available to those who need them the most.

As supreme commander of the armed forces I want to guarantee that the defensive capability of our country will no longer be used as a pretext for anyone to stand in the way of courageous peace initiatives, the reduction of military service, the establishment of alternative military service and the overall humanization of military life.

In our country there are many prisoners who, though they may have committed serious crimes and have been punished for them, have had to submit — despite the goodwill of some investigators, judges and above all defense lawyers — to a debased judiciary process that curtailed their rights. They now have to live in prisons that do not strive to awaken the better qualities contained in every person, but rather humiliate them and destroy them physically and mentally. In a view of this fact, I have decided to declare a relatively extensive amnesty. At the same time I call on the prisoners to understand that forty years of unjust investigations, trials and imprisonments cannot be put right overnight, and to understand that the changes that are being speedily prepared still require time to implement. By rebelling, the prisoners would help neither society nor themselves. I also call on the public not to fear the prisoners once they are released, not to make their lives difficult, to help them, in the Christian spirit, after their return among us to find within themselves that which jails could not find in them: the capacity to repent and the desire to live a respectable life.

My honorable task is to strengthen the authority of our country in the world. I would be glad if other states respected us for showing understanding, tolerance and love for peace. I would be happy if Pope John Paul II and the Dalai Lama of Tibet could visit our country before the elections, if only for a day. I would be happy if our friendly relations with all nations were strengthened. I would be happy if we succeeded before the elections in establishing diplomatic relations with the Vatican and Israel. I would also like to contribute to peace by briefly visiting our close neighbors, the German Democratic Republic and the Federal Republic of Germany. Neither shall I forget our other neighbors — fraternal Poland and the ever-closer countries of Hungary and Austria.

In conclusion, I would like to say that I want to be a president who will speak less and work more. To be a president who will not only look out of the windows of his airplane but who, first and foremost, will always be present among his fellow citizens and listen to them well.

You may ask what kind of republic I dream of. Let me reply: I dream of a republic independent, free, and democratic, of a republic economically prosperous and yet socially just; in short, of a humane republic that serves the individual and that therefore holds the hope that the individual will serve it in turn. Of a republic of well-rounded people, because without such people it is impossible to solve any of our problems — human, economic, ecological, social, or political.

The most distinguished of my predecessors opened his first speech with a quotation from the great Czech educator Komenský. Allow me to conclude my first speech with my own paraphrase of the same statement:

People, your government has returned to you!’

Sunday, 11 December 2011

A Favourite Fallacious Fallacy

Taking up the theme of Christian 'logic' again, I was pondering on a comment, left on my blog "How Dan Destroys The Bible" by someone who, perhaps understandably, wants to remain anonymous.

"In no sense is an argument a valid one if it is built upon the accuracy of what it is arguing is inaccurate. If the bible is false, then those entries are false, and cannot, therefore be used as part of your argument to show that the bible is false. You've created a loop. If those entries are true, then the bible is true, therefore your argument is false."

I understand this is known as the "Taxicab Fallacy" and is a favourite of Christian apologist and genocide and child-murder defender, William Lane Craig. For an excellent blog on this see The Fallacy of the "Taxi Cab Fallacy" by Plasma Engineer.

I couldn't find a picture of the Taxicab Fallacy so here's a parrot to
represent people who spout apologetic fallacies without thinking
about them.

Yes, I know it's not a parrot, it's a kestrel, but you can't use that
error to prove it's not a parrot.  Taxicab fallacy you see.
I thought it might be fun to see what we can do with this device which Christians and Muslims try to use to overcome the embarrassment of having holy books supposedly written/inspired by omniscient gods but which contain mistakes of fact or reason.

Imagine you're in court charged with a crime of which you are completely innocent and the prosecution have put up a statement by an eye-witness as evidence against you.  The statement says the crime was committed on a Tuesday afternoon by a 6 feet tall, 220 lbs (15 stone 12 lbs if you're not American) woman with red hair and one leg. Your defence has pointed out that you are a 5 feet 6 inch male with black hair and the full complement of legs, and that the crime was actually committed on a Friday morning.

"Ah!", Say the prosecution, "but you can't use the errors in the statement to prove the statement is false because in no sense is an argument a valid one if it is built upon the accuracy of what it is arguing is inaccurate. If the statement is false, then those entries are false, and cannot, therefore be used as part of your argument to show that the statement is false. Therefore you have no grounds for questioning the accuracy of the witness statement".

"Got a good point there!", says your defence lawyer. "Can't dispute that logic!"

I wonder if my anonymous contributor would put his hands up and admit he/she must be guilty in that case because the witness statement is obviously true, or whether he would fire his defence lawyer.

I'm wondering is this 'logic' is just confined to written words or if it applies to other faulty things. In the UK we have a consumer-protection law called the "Trade Descriptions Act" which makes it an offence to lie about goods offered for sale. For example, it is illegal to state that a food item contains fewer calories than it actually contains, or that a washing powder makes your children glow in the dark when it doesn't.

I wonder if a rogue trader could get away with arguing that you can't use these errors as proof that his descriptions were wrong and misleading because, if the description is false, then those entries are false, and cannot, therefore be used as part of your argument to show that the description is false. The description is therefore true and not misleading.

I think if I took my car to the local garage because the lights didn't work and was told that the lights must be working because you can't use the fault to prove there is a fault with the lights, I might well use another garage in future.

As we can see, religious apologists have no worries about using the tactics of false witnesses, rogue traders or cowboy mechanics to pull the wool over the eyes of their followers who seem to have so much wool between their ears that this is almost too easy to do.

Thursday, 8 December 2011

Theists for Genocide

"Religion is an insult to human dignity. With or without it you would have good people doing good things and evil people doing evil things. But for good people to do evil things, that takes religion." - Steven Weinberg

Continuing my theme of religions giving permission to extremists, this is a collection of writing, pictures, cartoons, Twitter tweets and blogs in which religion is used to excuse and even advocate crimes against humanity such as violent persecution, genocide, mass murder against people with different beliefs or none. Things which any decent person with even a modicum of respect for their fellow human beings would look at and say, "That's wrong! And if your religion tells you it's right, your religion is wrong too." (Tweet this)

It is an on-going project and will be added to as more material is gathered. Examples please.

Justifying Genocide: The Role of Professionals in Legitimizing Mass Killing by Alex Alvarez explains how this works

First, a quote by the Christian apologist William Lane Craig, current darling of the US religious right who seems to have embarked recently on a campaign to make genocide and child mass-murder look like a Christian moral crusade (and I use that word deliberately). The full text may be read here.

"According to the Pentateuch (the first five books of the Old Testament), when God called forth his people out of slavery in Egypt and back to the land of their forefathers, he directed them to kill all the Canaanite clans who were living in the land (Deut. 7.1-2; 20.16-18). The destruction was to be complete: every man, woman, and child was to be killed. The book of Joshua tells the story of Israel’s carrying out God’s command in city after city throughout Canaan.

[...]

So then what is Yahweh doing in commanding Israel’s armies to exterminate the Canaanite peoples? It is precisely because we have come to expect Yahweh to act justly and with compassion that we find these stories so difficult to understand. How can He command soldiers to slaughter children?

[...]

I think that a good start at this problem is to enunciate our ethical theory that underlies our moral judgements. According to the version of divine command ethics which I’ve defended, our moral duties are constituted by the commands of a holy and loving God. Since God doesn’t issue commands to Himself, He has no moral duties to fulfill. He is certainly not subject to the same moral obligations and prohibitions that we are. For example, I have no right to take an innocent life. For me to do so would be murder. But God has no such prohibition. He can give and take life as He chooses.

[...]

So the problem isn’t that God ended the Canaanites’ lives. The problem is that He commanded the Israeli soldiers to end them. Isn’t that like commanding someone to commit murder? No, it’s not. Rather, since our moral duties are determined by God’s commands, it is commanding someone to do something which, in the absence of a divine command, would have been murder. The act was morally obligatory for the Israeli soldiers in virtue of God’s command, even though, had they undertaken it on their on initiative, it would have been wrong.

On divine command theory, then, God has the right to command an act, which, in the absence of a divine command, would have been sin, but which is now morally obligatory in virtue of that command.

[...]

But why take the lives of innocent children? [...] if we believe, as I do, that God’s grace is extended to those who die in infancy or as small children, the death of these children was actually their salvation. We are so wedded to an earthly, naturalistic perspective that we forget that those who die are happy to quit this earth for heaven’s incomparable joy. Therefore, God does these children no wrong in taking their lives.

So whom does God wrong in commanding the destruction of the Canaanites? Not the Canaanite adults, for they were corrupt and deserving of judgement. Not the children, for they inherit eternal life. So who is wronged? Ironically, I think the most difficult part of this whole debate is the apparent wrong done to the Israeli soldiers themselves. Can you imagine what it would be like to have to break into some house and kill a terrified woman and her children? The brutalizing effect on these Israeli soldiers is disturbing."


So here we have a leading Christian apologist telling those so inclined that genocide and child mass-murder is good and it's not their fault when they do it. They are merely obeying a god's command and carrying out its wishes. Why, it would almost amount to a sin; to moral failure even, NOT to kill people who don't share your religion. And don't worry about such scruples as finding child murder distasteful or shocking. It's all to the good, and anyway it's actually good for children - it makes them happy!

And if you're tempted not to believe it, here is William Lane Craig saying it:


Just obey those voices in your head (or more likely, the voices of the right-wing politicians and their dutifully obedient clerics who tell you a god told them to tell you) and you have no responsibilities for the consequences of your actions. You have this on the personal assurance of William Lane Craig - not that HE would do such a thing, of course.

Note the several examples of suggestible and inadequate individuals taking up this theme and now feeling part of a new, exciting movement, in the Twitter tweets defending William Lane Craig's repugnant apologetic. Christians expressing horror at it and taking Lane Craig to task are, naturally, as rare as hens' teeth.

The following illustrates how suggestible amateur apologists then proudly take up this theme, free from any feelings of guilt, on the grounds that anything a god orders is moral, regardless of the consequences, safe in the knowledge that this view is now 'respectable' and somehow reveals a new understanding and insight to be taken up with the zeal of a crusade.



Here we see Radovan Karadžić at his trial for war crimes, explaining how the Bosnian genocide  in former Jugoslavia was good and 'holy'.

What are the odds that his comrade in arms, fellow Greek Orthodox Christians, Ratko Mladić offers up the same justification.

And of course, these people gave permission to, and even participated directly in, the atrocities following the break up of the former Jugoslavia.

"It's not a pleasant job, but somebody has to do it. It's all to the good in the end!"

I wonder how many guards and Kommandants at Treblinka, Dachau, Belson, Buchenwald and Sobibor said that.

In this blog, (Toisin's Bible Blog) entitled "The Love Of God And Genocide" (No! Really!) also by a Christian we find people being compared to sick animals again, so genocide and child murder are equated to some sort of mercy killing; unpleasant but all to the long-term good. Even an act of love on the part of the perpetrator to whom we should be grateful and sympathetic.

"Not a pleasant job, but someone had to do it".

"I guess most people would already know about the 6million Jewish people killed through Nazism. This last statement is absolutely true, and I will research and post sources  to corroborate it.  However, this fact does not change the fact that yes, our loving God ordered these massacres, and yes, genocide is a very appropriate term for the massacres He ordered.  How do we reconcile this with our faith?

[...]

In the Bible, people are often compared to sheep. You know when the foot and mouth disease hit the UK, or in fact any contagious animal disease hits anywhere, culls of whole animal populations are ordered. Why? To stop the diseases spreading any further. Sometimes farmers are distraught at having to kill so many of their animals, yet everyone knows that if those animals were not killed, then even more animals would ultimately be lost. So it was with those cultures that God ordered to be destroyed. They were utterly saturated with the deadly and contagious illnesses of horrible sin. When foot and mouth strikes, you don’t say “Let’s spare the babies.” You have to systematically kill everything. And yet, the fact that a farmer kills so many of his animals does not mean that he does not love them, especially when he has carefully tended them and invested his very self into them. God invested His own image into all humanity. I know that this was a moral issue rather than a physical illness, so I sometimes think that surely, sometimes the children could have been spared, as they were too young to have imbibed the evil sinful practices and the attitudes of the adults. And in many cases children were spared. And yet in some cases God specifically commanded that even children – even animals were to be totally destroyed. I believe that in these passages God is using these civilisations as symbols for how sin has to be utterly destroyed. Remember that He is God, He is the Creator, He can do that."


Probably little more need be said about this nauseating blog save to point out that "Toisin" seems ignorant of much of history, or at least is hoping his readers are. From the style of writing it would appear that "Toisin" is very young so perhaps the interesting point here is how he/she has picked up the permission to commit genocide currently being promulgated by William Lane Craig and his acolytes.

I hope the relative of the victims of the Holocaust derive some comfort from the thought that their loved ones died as an act of mercy to prevent the rest of us catching their disease, and that their deaths were ordered by a 'loving' god for the good of humanity, or simply because he can.

Interestingly, the only comments to date (10 Dec 2011), apart from my own, have been from Christians complimenting Toisin and thanking him for helping them to reconcile genocide with a loving god. None of them have questioned whether acts of genocide done in it's name could actually raise questions about it's 'loving' nature, or it's existence.

In this blog, entitled "Why does the Bible Condone Genocide" by Christian apologist John Hendryx, at least there is none of the nauseating equation of humans with diseased animals, nor the claim that killing them was good for them; that we're doing them a favour for which they should be grateful, actually.

Instead we are simply assured that the Christian god has the right to do what it wants with humans and just uses believers to carry out its tasks, so freeing them of personal responsibility for their crimes and allowing them the excuse of blaming them on a god.

Anyway, they were going to die eventually, so what harm was there? The murderers were just doing their god's work, so are to be admired.

Obviously, to this school of Christian 'morality', human life is of little value, so long as it's someone else's life. Notions of human rights and human dignity are unknown. We are nothing more than the playthings of their capricious and mendacious god and killing people is simply hastening the inevitable a little.

"Before we get to Canaan, consider this further point: not only may God take life as he sees fit – he does take the life of every last human on earth (see Heb. 9:27)."

[...]

A couple more points may be helpful to keep the slaughter of the Canaanites in perspective: first, at that time in the OT, God had given the nation of Israel clear civil authority and responsibilities; and as a lawfully-ordained civil government, functioning directly under his control, He commanded them to carry out His just judgment against the idolaters of Canaan.

[...]

When it is a judicial act of a properly instituted civil government, taking a life may sometimes be warranted. Apparently, the slaughter of the Canaanites was one such judicial act, carried out by the magistrates of Israel."
Corpses piled up behind the crematorium in Buchenwald concentration camp,
 April 1945

So, it's also okay so long as it's done with the approval of the government. No doubt Ratko Mladic will be relieved to know that, though it's a point which, strangely, the jurists at Nuremberg failed to appreciate.

It's also a point which those who formulated and signed the Geneva Convention seem to have missed.

"Just obeying orders, yer honour! Anyway, a god told me to do it!"

So we see how religions, which purport to sanctify and value human life, reduce it to a worthless thing, easily extinguished to satiate the blood-lust or territorial ambitions of their followers and to permit the actions they purport to condemn and abhor - when it's expedient so to do.

People who can believe the blood sacrifice of an innocent person can absolve them of personal responsibility for their own sins, have a low regard for life, it seems. Someone else's life only has a utility value in terms of it's usefulness to them.

This example of a wanabee genocidist sitting at home casually and anonymously calling for the murder of everyone who disagrees with him, illustrates the point rather nicely I think.

'Keith' clearly feels he has permission to call for this because it is for the good of society and even his patriotic duty (as long as someone else does it, no doubt).

No need any longer to bother about such niceties as right and wrong or whether your superstition has any merit; just kill everyone and have done with it, then there won't be anyone to bother you with those annoying little questions.

And dress the whole thing up as a moral crusade. Nowhere in it is there any hint of valuing human life or consideration of human worth. It's all for me and only I matter.

And still they come, though this one is struggling to explain in exactly what context child murder and genocide are right for Christians. Will update when he's decided, if ever.

Tuesday, 6 December 2011

Talking Bible Babble

Continuing the theme in my blog yesterday on the Bible's disconnect from reality, here's an amusing tale from Hebrew mythology tucked away in the Bible, telling of an act of their tribal god:
Tower of Babel, Pieter Bruegel the Elder (1563)

Genesis 11:1-9 And the whole earth was of one language, and of one speech. And it came to pass, as they journeyed from the east, that they found a plain in the land of Shinar; and they dwelt there. And they said one to another, Go to, let us make brick, and burn them thoroughly. And they had brick for stone, and slime had they for morter. And they said, Go to, let us build us a city and a tower, whose top may reach unto heaven; and let us make us a name, lest we be scattered abroad upon the face of the whole earth.

And the LORD came down to see the city and the tower, which the children of men builded. And the LORD said, Behold, the people is one, and they have all one language; and this they begin to do: and now nothing will be restrained from them, which they have imagined to do. Go to, let us go down, and there confound their language, that they may not understand one another's speech.

So the LORD scattered them abroad from thence upon the face of all the earth: and they left off to build the city. Therefore is the name of it called Babel; because the LORD did there confound the language of all the earth: and from thence did the LORD scatter them abroad upon the face of all the earth.


So, if this happened in the real world and the god described was an omniscient god, what would we expect to find? The god's clear intent was that people should not be able to understand one another, so we should see language groups rubbing shoulders on their borders with people who speak an entirely unrelated language. We would expect people speaking similar languages to be separated by great distances so that the chance of them coming up against people who could make a reasonable guess at what they were saying was virtually zero. We would expect to find people speaking a language similar to English to live in, say, South-east Asia or South America, and people who speak a language like Swedish to be found in Africa or Siberia. And of course,we would expect to find people speaking a Bantu language as far away from South Africa as possible, say in Canada, Norway or Australia.

Is this what we find?

Of course not. That's what the Bible predicts we should find so we can be fairly sure reality isn't going to be anything like that.

What we find is a reality about as far away from that as it's possible to get. We find precisely the opposite of what the Bible forecasts, of course.

I'll illustrate this with a few language maps I found with a few clicks on Google.





Well, that's the reality which, as we can see is a very different thing to the one we would expect if the myth of the Tower of Babel in the Bible was correct.

What we see in reality is EXACTLY what we would expect to see if language is an evolving cultural thing which we inherit from our cultures and our parent generation along with our other memes. We see diversification occurring due to isolation for various reasons like political borders, isolating valleys and mountain ranges, different religions or religious sects, etc. We also see remnant populations of earlier language groups isolated within larger populations like the Basques of North-eastern Spain and South-western France.

Some years ago on a night shift, I had been reading Beowulf, the earliest known work in Early English, with translation, obviously. One of my assistants, who is Anglo-Norwegian and speaks both languages fluently as well as Danish, Swedish and German, picked it up with a half-dismissive, "what's this you're reading now?", then she said, "Hey!  I can read this, almost!  Why are you reading old Danish?"  Of course she was right. Beowulf is no more English than it is Danish or Dutch. It was written in a language ancestral to, or at least close to one which was ancestral to Dutch and Danish and close to Swedish and Norwegian.

"Beowulf methelode, bearn Ecgtheowes; 'Hwaet, thu worn fela, wine win Unferth, beorne druncen, ymb Breccan spreace, suaegdest from his sithe. Soth ic talige thaet ic merestrengo maran ahte, aerfetho on ythum, thonne aenig other man.

[Beowulf spoke, the son of Ecgtheow: "Well, Unferth my friend, drunk with beer you have talked a great deal about Brecca, told of his adventures. I claim for a fact that I have greater strength in the sea, hardship of the waves, than any other man.]


One of my favourite language groups is the so-called Celtic groups found in the extreme edge of Western Europe.  This group is split into two main groups: the Goedelic and Brythonic groups, also called p-Celtic and q-Celtic.  They are the Irish and Scots Gaelic, and Welsh languages. They also include Manx (close to Irish Gaelic with some Welsh), Cornish, Breton from France and Galician from Spain (all close to Welsh). They are ancient languages, possibly related to the language spoken in Western Europe before the Roman conquest and maybe even to Cythian, though it's not at all certain that the modern Celts are the same people as the Keltoi as the Greeks called them or the people the Romans called Gauls.

The terms p-Celtic and q-Celtic come from the ancient words for 'son of' or more precisely, 'of the clan of', map and maq in Welsh and Gaelic respectively.  These have become the modern Ap (or Ab) in Welsh and Mac in Scots and Irish Gaelic. How many people today have the name Bevan (Ab Evan), Pritchard (Ap Richard) or Probert (Ap Robert) and how many millions of Macs and Mcs are there?  So we can trace these family names back to early origins in earlier languages and to the culturally related devise of using a clan name as a surname.

The Celtic word for king is also interesting. Forms of it appear in other related modern languages.  It is words like this which show how languages are related.  The Gaelic for king is rí. This word takes the form rex in Latin, roi in French and raj in Hindi and Urdu, so showing, along with many other words, how Gaelic, Latin and Hindi are all members of the Indo-European family of languages.  From this word, (via medieval French) we get the English words Royal, Regal and Reign.  Yes.  We still speak a local dialect of Indo-European.

The distribution, differences and similarities of human languages is precisely what we would expect of something which evolved and is still evolving.  It is exactly the opposite of what we would see it they had been been spontaneously created by an intelligent god.

Again, the disconnect between the Bible and reality is exposed with a brief look at reality.


ShareThis

Related Posts Plugin for WordPress, Blogger...