Pages

▼

Tuesday, 20 December 2011

Evolution - The Meaning of Information


Go to any creationist website and you will find any number of 'creation scientist' explaining to their credulous and gullible readership and potential customers that information theory proves that no new information can arise by a random process, or some such half-baked notion, so the Theory of Evolution must be wrong (so a magic man magicked everything and it must have been the locally popular one, obviously, as eny fule kno).

Where do they get these ideas from?

Mutations in DNA are relatively common because the copying process is not perfect, despite the mechanisms which have evolved to correct them.

I'll not go into the so-called genetic code here because, with a few clicks on Google, or by opening any of very many books on the subject, this can be easily found by those who wish to know more. Those who don't won't have bothered reading this far.

If anyone can tell me why a mutation which changes the genetic code for a small portion of a given enzyme from, let's say, UUAUAUCAUGUAGAUAACCCCUGA to UUAUCUCAUGUAGAUAACCCCUGA in the short sequence of mRNA, is prohibited by the second law of thermodynamics, I'd be very grateful...

Of course, there is no reason at all why this should be impossible; a proposition which is rendered even more absurd by the observable fact that it happens. There should be a clue here for Creationists. Hint: impossible things don't happen; things that happen are not impossible. (I appreciate the logic there might need more than a few moments thought for the average Creationist.)

So, what would this mutation do? In case you didn't notice, the second group of three letters has changed from UAU to UCU. In terms of the genetic code, this will mean the resulting protein will have the amino acid serine in place of tyrosine. The answer of course depends on what the protein does. If it's an enzyme, the chances are that, unless this section is from the functional part of the enzyme, it will have little or no effect at all.

So what new information has arisen by this mutation? Unless you regard changed information as new information, there is no new information. The information still tells a cell how to build the enzyme.

But what might have changed is the meaning of the information, and, just as with written language, the meaning of the information written down depends entirely on the environmental context. Written language only has meaning in the context of an environment in which literate speakers of the language exist. Otherwise, it has no more meaning than random marks on paper.

I'll illustrate this with a hypothetical, but possible, scenario:

In recent history, humans learned to harvest the natural sap of the rubber tree and use it as a material. A little latter, we learned to process this latex chemically by a process called vulcanisation which makes a much stronger substance suitable for making things like car tyres. Now millions of tons of vulcanized rubber are deposited annually on our roads and washed off into waterways or blown as dust into surrounding countryside to be incorporated into the soil.

Now, rubber is a natural substance, even in it's vulcanized form, so in theory is should be possible for a bacterium or a fungus to evolve the ability to process all this rubber in the environment. Maybe if only for the sake of road safety, we are fortunate that none has yet done so, so far as we know.

But, what if a mutation like the one I mentioned above were to change an enzyme in such a way that made this possible? What if this small change in information, in the context of all this man-made vulcanized rubber, gave a bacterium or a fungus a new source of energy?

What an advantage that would give it compared to forms carrying the non-mutated gene!

But what if this mutation had arisen, say, 500 years ago? It would, of course, have been completely meaningless and would have conveyed no advantage whatsoever. A mutation only has meaning in the context of the environment in which it arises. Out of that context it has no meaning at all.

It is the meaning of the information which changes and that depends on the environment. Environmental change drives evolution by giving meaning to the information in the genetic code. New meaning arises because new environments arise.
Advertisement

What Makes You So Special? From The Big Bang To You

How did you come to be here, now? This books takes you from the Big Bang to the evolution of modern humans and the history of human cultures, showing that science is an adventure of discovery and a source of limitless wonder, giving us richer and more rewarding appreciation of the phenomenal privilege of merely being alive and able to begin to understand it all.

Available in Hardcover, Paperback or ebook for Kindle

Advertisement

Ten Reasons To Lose Faith: And Why You Are Better Off Without It

This book explains why faith is a fallacy and serves no useful purpose other than providing an excuse for pretending to know things that are unknown. It also explains how losing faith liberates former sufferers from fear, delusion and the control of others, freeing them to see the world in a different light, to recognise the injustices that religions cause and to accept people for who they are, not which group they happened to be born in. A society based on atheist, Humanist principles would be a less divided, more inclusive, more peaceful society and one more appreciative of the one opportunity that life gives us to enjoy and wonder at the world we live in.

Available in Hardcover, Paperback or ebook for Kindle


Advertisement



Thank you for sharing!







submit to reddit

9 comments:

  1. Absolutely agreed, and trouble enough I have been having with tyres without them being nibbled!

    I thought yuour other readers might enjoy "Textual criticism of DNA - proof of evolution!" which they can find at http://ow.ly/7FGee (Something Surprising Blog). Hope you don't mind a little self-publicity.

    ReplyDelete
  2. Wonderfully concise explanation that anyone (who cares to) can understand.

    ReplyDelete
  3. Holy cow! I have been looking for a concise and easy-to-understand explanation of the 'information' thingy for a while and this is it! Richard Dawkin did write a very lengthy article on this shortly after some idiot creationists on youtube published a video of him failing to explain whether increment of information in DNA can be observed or something like that. But it was so huge I never never even dared to start reading it. Thank you Rosa. You obviously are a great teacher!

    ReplyDelete
  4. The BBC did a great series of 3 programmes about the cell. We know so much about DNA now. small chunks of DNA control the expression of other genes. Not only that, but there are master controller genes that switch groups of controllers on and off. And this chain of controllers could go further.

    Through this method, an entire eye can appear in a fruit fly in, for instance the tip of it's leg. Not only that, but the same controller gene from a mouse can be inserted into the fruit fly gene and cause the same effect. And , of course, all this without breaking the second law of theromodynamics.

    ReplyDelete
    Replies
    1. Hox genes. Carry out large-scale instructions like 'grow a leg' or 'grow an eye'. Interesting thing is that if you use a mouse hox gene for growing an eye on a fruit fly leg, it grows an eye, but a fruit fly eye.

      Hox genes control embryonic development.

      Delete
  5. Rosa,
    Subtle but valid points! As the Cellular Automation called "Game of Life" shows new complexity does arise from simple rules. But another way of looking at is that in a deterministic universe the future contains no new information than the past. Which view does your article tend to support ?
    Another interesting point you made, is that meaning occurs only in context.
    This is a bit off topic; but does there exist a context in which any random scrbbling has meaning ?

    ReplyDelete
    Replies
    1. > but does there exist a context in which any random scrbbling has meaning ?

      In a selective environment in which there there is replication with errors.

      Delete
  6. I point people who put forward the information argument to this article regularly. I would even go further and say that there is no such thing as information in genes at all (at least in the sense they mean). In other words, it's not really a language. It's just chemicals doing what chemicals do.

    ReplyDelete
  7. Yes, I say like Anowanul Kabir, Thank you Rosa. You obviously are a great teacher!

    But even more intriguing and fascinating information can be found in your own comment, Rosa, where you write: Hox genes. Carry out large-scale instructions like 'grow a leg' or 'grow an eye'. Interesting thing is that if you use a mouse hox gene for growing an eye on a fruit fly leg, it grows an eye, but a fruit fly eye. Hox genes control embryonic development.

    Why not write a new blog on that topic (how hox genes control embryonic development)? How, for example, do the interactions between genes/inheritance and environment look like, so that a mouse hox gene used "for growing an eye on a fruit fly leg [results in a new] eye, but [then] a fruit fly eye".

    In Genesis one can't read anything at all about how the Creator was working when creating life and different life forms. Except for the information in Genesis 2:7 (Then the Lord God formed a man from the dust of the ground and breathed into his nostrils the breath of life, and the man became a living being) and Genesis 2: 21-22 (So the Lord God caused the man to fall into a deep sleep; and while he was sleeping, he took one of the man’s ribs and then closed up the place with flesh. 22 Then the Lord God made a woman from the rib he had taken out of the man, and he brought her to the man).

    I therefore suspect that you know much more about evolution and genetics than Almighty God in Heaven does. But remember, Rosa, this not an order from me. I know that you're a busy woman (for example very active in the Facebook group "WHY ATHEISM?" plus writing new intriguing blog articles many times a week. So you don't have time, like God, to choose a day of rest going on for a thousand years or so.

    ReplyDelete

Obscene, threatening or obnoxious messages, preaching, abuse and spam will be removed, as will anything by known Internet trolls and stalkers, by known sock-puppet accounts and anything not connected with the post,

A claim made without evidence can be dismissed without evidence. Remember: your opinion is not an established fact unless corroborated.