Where do religious institutions get this idea that somehow they should be included in the institutions of government or that our elected representatives should pay them any attention beyond that due to any other member of society? Religious institutions are by their nature, autocratic and undemocratic, even anti-democratic. All are self-appointing, self-interested organisations which exist ONLY for their own aggrandisement and perpetuation.
Few, if any religions have a democratically elected leadership. Few if any of them are accountable to their members for policy and/or doctrine. Almost all of them have a top down structure which is answerable only to itself.
Where then do they get their authority to interfere in government and the right to influence the nature and structure of society? They can't even claim to represent the opinions of their members since they never seek to discover them. Indeed, almost every religious service seems to consist of autocrats telling their members what they should believe.
Nauseated by repeated attempts by religious apologists to claim Albert Einstein as one of theirs and so deceive their gullible followers, I reproduce a letter Einstein wrote in German to Erik Gutkind in January 1954, a year before he died. In it, he refutes any suggestion that he believes in anything resembling the Judeo-Christian god.
An English translation:
Princeton, 3. 1. 1954
Dear Mr Gutkind,
Inspired by Brouwer’s repeated suggestion, I read a great deal in your book, and thank you very much for lending it to me ... With regard to the factual attitude to life and to the human community we have a great deal in common. Your personal ideal with its striving for freedom from ego-oriented desires, for making life beautiful and noble, with an emphasis on the purely human element ... unites us as having an “American Attitude.”
Still, without Brouwer’s suggestion I would never have gotten myself to engage intensively with your book because it is written in a language inaccessible to me. The word God is for me nothing more than the expression and product of human weakness, the Bible a collection of honorable, but still purely primitive, legends which are nevertheless pretty childish. No interpretation no matter how subtle can (for me) change this. ... For me the Jewish religion like all other religions is an incarnation of the most childish superstition. And the Jewish people to whom I gladly belong ... have no different quality for me than all other people. As far as my experience goes, they are also no better than other human groups, although they are protected from the worst cancers by a lack of power. Otherwise I cannot see anything “chosen” about them.
In general I find it painful that you claim a privileged position and try to defend it by two walls of pride, an external one as a man and an internal one as a Jew. As a man you claim, so to speak, a dispensation from causality otherwise accepted, as a Jew of monotheism. But a limited causality is no longer a causality at all, as our wonderful Spinoza recognized with all incision...
Now that I have quite openly stated our differences in intellectual convictions it is still clear to me that we are quite close to each other in essential things, i.e. in our evaluation of human behavior ... I think that we would understand each other quite well if we talked about concrete things.
Einstein reinforced this in a letter to J. Dispentiere on 22 March 1954, in which he said:
It was, of course, a lie what you read about my religious convictions, a lie which is being systematically repeated. I do not believe in a personal God and I have never denied this but have expressed it clearly. If something is in me which can be called religious then it is the unbounded admiration for the structure of the world so far as our science can reveal it.
Despite this denial, religious apologists continue to claim Einstein was religious. Obviously, it's much safer to claim a dead scientist as one of your own when fewer and fewer living ones are. Tweet
No, don't worry, I haven't suddenly taken leave of my senses, abandoned logic, reason and rational thinking and 'found God'.
Several time a week you'll see some fundamentalist Christian or Muslim come on to Twitter and claim to have been "an Atheist just like you", or to be "a former Atheist who's found the peace of Jesus/Allah... blah!... blah!... blah!".
And of course, blogs making that claim are ten a penny.
I say they are either lying or have not bothered to understand what Atheism is.
I say that for this reason:
Atheism is NOT just not going to church/mosque or not praying or not reading the local holy book.
And I looked, and, behold, a whirlwind came out of the north, a great cloud, and a fire infolding itself, and a brightness was about it, and out of the midst thereof as the colour of amber, out of the midst of the fire.
Also out of the midst thereof came the likeness of four living creatures. And this was their appearance; they had the likeness of a man. And every one had four faces, and every one had four wings. And their feet were straight feet; and the sole of their feet was like the sole of a calf's foot: and they sparkled like the colour of burnished brass.
And they had the hands of a man under their wings on their four sides; and they four had their faces and their wings. Their wings were joined one to another; they turned not when they went; they went every one straight forward.
As for the likeness of their faces, they four had the face of a man, and the face of a lion, on the right side: and they four had the face of an ox on the left side; they four also had the face of an eagle. Thus were their faces: and their wings were stretched upward; two wings of every one were joined one to another, and two covered their bodies.
And they went every one straight forward: whither the spirit was to go, they went; and they turned not when they went. As for the likeness of the living creatures, their appearance was like burning coals of fire, and like the appearance of lamps: it went up and down among the living creatures; and the fire was bright, and out of the fire went forth lightning.
And the living creatures ran and returned as the appearance of a flash of lightning.
Ezekiel 1:4-14
Well, the only thing to say to that is, "I'll have a glass of whatever he was drinking".
Seriously though, I guess people knew little of mental health problems and the effects of substance abuse in those days but, in this day and age, do sane people really hang on every word of people who come out with stuff like that?
Would you follow someone who was ranting this stuff on a street corner near you?
Seriously?
Me neither. I'd assume their medication needed reviewing or they had stopped taking it.
In the UK, The National Health Service spent £442,000,000 on pain killers alone last year. In the USA the analgesics market is said to be worth $2,800,000,000, that's $2.8 billion, per annum. Clearly, pain is seen as a major medical problem and something to be overcome, even at considerable expense. Most people can imagine few things more distressing than constant chronic pain.
How many times have you heard piously self-righteous Christians and Muslims gleefully telling those who disagree with them that they can expect an eternity of pain and suffering for doing so? Suffering eternal pain seems to be the worst thing at least some humans can imagine.
There seems to be nothing to be said for pain at all. Yet we even have specialised nerve endings for feeling pain and centres in our brains for processing the information they provide and turning this into the conscious unpleasant experience we call pain. Indeed, the normal responses of our bodies to injury often seem designed to INCREASE the pain of injury.
So why have we evolved the ability to feel pain?
Put simply, pain tells us something is wrong. Pain draws our attention to injury or disease. Pain says do something or don't do something; guard me, rest me or don't use me. Don't walk on that broken ankle because it needs to be rested. Don't carry on with that chest pain but slow down and take a rest. Don't bite on that tooth or raise that broken arm. Close your eyes and sleep when that headache becomes unbearable. Put your hand over your ear when cold wind makes it ache and change your shoes when that blister bursts...
Pain even initiates reflexes which happen before our brains have noticed. These spinal reflexes have evolved to protect various parts of our bodies and pain is the signal to act automatically without the normal luxury of thinking about it first.
Pain has evolved as a signal. It is unpleasant because that tells us to try to stop it by resting or guarding the hurting part of our body. Pain is unpleasant because we have evolved to perceive it as unpleasant. Being unpleasant means we do something about it to reduce the unpleasant sensation.
Consider a patient dying in extreme pain of cancer, or an abscess, or a disabling injury in the absence of any pain relief? What possible purpose could that serve the individual?
Consider a gazelle dying of the shock of having it's intestines pulled out and its liver eaten by lions whilst still alive, or the zebra having a leg torn off by a crocodile as it is slowly drowned.
How does pain serve these individual?
Nature is unemotional and entirely lacking in compassion. Nature doesn't care about the suffering of a prey species as it is eaten and yet we can be quite sure that every sentient creature, and probably many others, feel pain. Nature has no concern at all for the discomfort or distress of an animal suffering from infection or dying of disease or simply starving to death of old age.
The fate of almost every living multi-cellular thing is to die of disease, or by being eaten, or of starvation due to injury or old age. There are very many ways to die and none of them are pleasant. Millions of feeling animals die every day in great pain. A system which has evolved to keep you alive is useless when you are dying, and yet it is still demanding you do something even when there is nothing you can do.
So why should we have evolved something we don't like and why would it be at its most insistent when at its most useless? What intelligent designer would design such a thing?
Because evolution isn't driven by what we like or dislike; evolution is driven by whatever ensures we have more descendants than we would otherwise have. Evolution is determined by what is in the interests of our genes because it is our genes which either survive in the next generation, or don't. And there is no benefit to our genes in evolving a mechanism to turn pain off when it is no longer any use.
So, evolution has provided us with something we don't like, and this is perfectly understandable in terms of mindless, unemotional, uncaring, genetic evolution.
What is not understandable is how this could have been designed by an intelligent, loving, caring and compassionate god. If pain has been designed by a god then that god must be a stupid, cruel, sadistic and hateful god.
Pgs. 41-44 Guilt by association fallacy & faulty analogy. The Watergate conspirators were not being promised eternal rewards in heaven. If these martyrs existed, I have no doubt they BELIEVED, which is irrelevant to actual events.
Pgs. 45-46 Appeal to Authority fallacy
Pg. 47 "Strong evidence that the NT written at an early date" not supported in text. Only assertions.
Pg. 48 "Oral tradition not long enough.." Proof? Evidence?
Pgs. 49-51 So there's no originals. Therefore unknown numbers of errors.
Pg. 60 "One test of a writer is consistency" Agreed. Luke fails.
Pgs. 61-62 The same standard must be set to the Bible as other secular literature. No. Extraordinary claims require extraordinary proof. Otherwise it must be treated the same as other ancient records of legends such as Hercules.
Pgs. 62-63 Criterion of embarrassment argument. Limited in application and not proof that the event happened as described. May be used to fit writer's theology.
Pgs. 65-69 I felt the same joy when released from indoctrination.
Pgs. 73-79 Preaching and selling stuff.
Pgs. 81-83 Disagree. Bible is consistent only in it's inconsistency. It shows every indication of being written by ancient superstitious people.
Podcasts by Peter Coote (@cootey59) also dealing with this may be heard here.
Hoax or History? I vote Hoax
[Yet to be added: Josh McDowell's reply.]
[Further update: despite repeated invitations spread over several weeks, Josh McDowell failed to reply or even acknowledge the invitations.]
Worth the long read to see the depths Christian apologists will go to to keep their market intact and their income stream flowing.
And more in Anthony Flew's Bogus Book, by the same author.
My thanks to @jablomih on Twitter for providing me with the link. In his words, "Can you imagine atheists circling William Lane Craig's deathbed looking for a "conversion"? Or lying & saying he had one?"
When you show the world you know you need to lie for your cult, you show the world you know your cult is for fools who'll believe falsehoods.
In England we have the Serious Crimes Act 2007 Part 2 of which came into force in 2008. Section 59 removed the Common Law offence of incitement and replaced it with the criminal offence of Encouraging or Assisting Crime defined as:
Section 44. Intentionally encouraging or assisting an offence.
Section 45. Encouraging or assisting an offence believing it will be committed.
Section 46. Encouraging or assisting offences believing one or more will be committed.
It would be astonishing if other civilized countries didn't have similar laws.
So what has this to do with the Bible?
For every one that curseth his father or his mother shall be surely put to death: he hath cursed his father or his mother; his blood shall be upon him.
Leviticus 20:9
Incitement to commit murder.
And the man that committeth adultery with another man's wife, even he that committeth adultery with his neighbour's wife, the adulterer and the adulteress shall surely be put to death.
Leviticus 20:10
Ditto.
And the man that lieth with his father's wife hath uncovered his father's nakedness: both of them shall surely be put to death; their blood shall be upon them.
Leviticus 20:11
Ditto.
And if a man lie with his daughter in law, both of them shall surely be put to death: they have wrought confusion; their blood shall be upon them.
Browsing casually through the KJV Bible today, I came across these curious passages.
According to Matthew, Jesus tells a tale about a wise man building his house on rock and a foolish man building it on sand. He then prophecies that a house built on rock won't fall down but one built on sand will.
Therefore whosoever heareth these sayings of mine, and doeth them, I will liken him unto a wise man, which built his house upon a rock: And the rain descended, and the floods came, and the winds blew, and beat upon that house; and it fell not: for it was founded upon a rock.
And every one that heareth these sayings of mine, and doeth them not, shall be likened unto a foolish man, which built his house upon the sand: And the rain descended, and the floods came, and the winds blew, and beat upon that house; and it fell: and great was the fall of it.
Matthew 7:24-27
Well, that's pretty obvious really. It doesn't take a genius to come to come up with that, does it?
But what's this a little later on?
Matthew then tells us this curious tale:
And Simon Peter answered and said, Thou art the Christ, the Son of the living God. And Jesus answered and said unto him, Blessed art thou, Simon Barjona: for flesh and blood hath not revealed it unto thee, but my Father which is in heaven. And I say also unto thee, That thou art Peter, and upon this rock I will build my church; and the gates of hell shall not prevail against it.
Matthew 16:16-18
Hmm... so Matthew has Jesus choosing Simon Barjona as the rock upon which to build his church. Note the use of the singular there; "my church", not "my churches". He also has Jesus prophesying that "the gates of hell shall not prevail against it". Again the singular 'it'.
But what happened to this church? How did that prophecy turn out?
Is there just one true church?
Clearly not. Apart from the major schisms between the Roman and Orthodox Church, there are also the earlier schisms between the Coptic, Armenian and Maronite Christian churches, the Cathars, the Paulicians, Lollards, Hussites, etc. Then of course the various other schisms like that between the Catholic and Protestant churches.
And then the storm really hit. The Protestant church almost immediately fragmented into all the various sects like Lutherans, Calvinists, Quakers, Presbyterian, Baptist, Anabaptist, Seventh Day Adventist, Methodist, Anglican or Episcopalian, etc, etc, etc, and the Baptist sect alone promptly shattered again into a myriad different churches so that today we have some 40,000 different churches, all claiming to be the one true church and, at least by implication, that all the others are false, and therefore Satanic.
Ravening Wolf
The One True Church Jesus built on Simon 'The Rock' Barjona has shattered like grains of sand, and the gates of hell seem to have prevailed against it, if you believe all the present churches, that is.
Curious how all these modern-day priests seem to want their 'flock' to believe that Jesus was a foolish man, a false prophet and a poor judge of character in his choice of Simon, and that the Gates of Hell have indeed triumphed over Jesus' church, eh?
Or was Matthew up to something when he made up those tales?
What's that you say, Matthew?
Beware of false prophets, which come to you in sheep's clothing, but inwardly they are ravening wolves.
Matthew 7:15
Hmm... so beware of Jesus, the ravening wolf clothed as a lamb, eh?
Blimey! Subversive, or what!? You'd have thought the Bible's editors would have picked that one up.
I'm glad I'm not a Christian so I don't have to work out ways to ignore this sort of hopeless muddle.
I heard an interesting thing today. At least I find it interesting.
Apparently, in the fifteenth century, Turkish traders started supplying England with the helmeted guinea fowl, Numida meleagris, a bird found wild in East Africa which had been domesticated there for about 4000 years and was so named because of the strange bony structure it has on its head.
It had been introduced by the Romans 1400 years earlier, but had been lost with the collapse of the Roman Empire.
These traders were known as Turkish or Turkey Traders and, by the sort of popular misunderstanding which helps create new words in a language, these birds became popularly known as turkeys. They were a popular meat at Christmas because they tasted good and had a fair amount of meat on them.
Later, when the distantly related wild bird, Meleagris gallopavo, now know as the turkey, was introduced from the New World, because it looked and tasted a bit like the 'turkey' it was mistakenly also called a turkey. As the helmeted guinea fowl fell out of favour, the name transferred to the New World bird.
So, a New World bird came to be known indirectly by the same name as a country with which it had absolutely no direct connection.
Like so much else with the European Yuletide, midwinter festival onto which the Christian Nativity myth has been grafted because the church couldn't bear being left out, turkeys have nothing to do with the Bible stories on which the myths are based.
Nor do holly, ivy, mistletoe, plum puddings, mince pies, dates, figs, the giving of gifts or even the season of goodwill to all men, wassailing and yule logs.
Go to any creationist website and you will find any number of 'creation scientist' explaining to their credulous and gullible readership and potential customers that information theory proves that no new information can arise by a random process, or some such half-baked notion, so the Theory of Evolution must be wrong (so a magic man magicked everything and it must have been the locally popular one, obviously, as eny fule kno).
Where do they get these ideas from?
Mutations in DNA are relatively common because the copying process is not perfect, despite the mechanisms which have evolved to correct them.
I'll not go into the so-called genetic code here because, with a few clicks on Google, or by opening any of very many books on the subject, this can be easily found by those who wish to know more. Those who don't won't have bothered reading this far.
If anyone can tell me why a mutation which changes the genetic code for a small portion of a given enzyme from, let's say, UUAUAUCAUGUAGAUAACCCCUGA to UUAUCUCAUGUAGAUAACCCCUGA in the short sequence of mRNA, is prohibited by the second law of thermodynamics, I'd be very grateful...
If the Judeo-Christian god want us to believe in him, why doesn't he:
Do to each of us what he allegedly did to Saul on the road to Damascus?
Become incarnate and perform public miracles at every generation, as he allegedly did to Moses and as Jesus?
Spontaneously appear and end a famine, stop a war, cure a disease or prevent a natural disaster?
Why didn't he:
Create a universe, solar system and life on earth in such a way that it is totally unexplainable by science, and leaving him as the only possible explanation above all other possible gods?
Create life on earth so that it cannot be explain by ideas of common descent and divergence; so that comparative anatomy and physiology can find no connections or similarities between different species; that there are no classes intermediate between fish and mammals, or similarities between humans and other life forms; that each species had an entirely different genetic code, or no code at all; with no fossil evidence suggesting an evolutionary process with regular extinctions?
Create a flat earth so it could not be logically explained any other way than by divine creation?
Create an earth with no geological evidence suggesting it is very old and has formed by a dynamic process over a very long time?
Created an earth with no evidence of unintelligent design?
Created a monument to Abraham which could be accurately dated?
Arranged for there to be archaeological and independent historical evidence of the Exodus, the wandering of the Israelites in Sinai, the destruction of the Canaanites, the massive economic collapse of Egypt following the plagues and the loss of it's slave population, etc?
Left unarguable evidence of a universal flood and made remains of Noah's Ark easy to find and validate?
Why doesn't he:
Make Christians nicer people who actually do what they tell others they should do?
Answer prayers in ways too obvious to be disputed, making Christians people we can go to to get our problems sorted by prayer?
Produce evidence that prayer works so that scientific studies would always show overwhelming evidence of their efficacy?
Create a single, world-wide religion?
Predict future events precisely so that we can see clearly the validity of the prediction?
Create a religion which, unlike all other known religions, is not disbelieved by a majority of the world's people?
In short, why doesn't the Judeo-Christian god seem to want people to believe in him?
Thus saith the LORD of hosts, the God of Israel; Put your burnt offerings unto your sacrifices, and eat flesh. For I spake not unto your fathers, nor commanded them in the day that I brought them out of the land of Egypt, concerning burnt offerings or sacrifices: But this thing commanded I them, saying, Obey my voice, and I will be your God, and ye shall be my people: and walk ye in all the ways that I have commanded you, that it may be well unto you.
Jeremiah 7: 21-23
And the LORD called unto Moses, and spake unto him out of the tabernacle of the congregation, saying, Speak unto the children of Israel, and say unto them, If any man of you bring an offering unto the LORD, ye shall bring your offering of the cattle, even of the herd, and of the flock. If his offering be a burnt sacrifice of the herd, let him offer a male without blemish: he shall offer it of his own voluntary will at the door of the tabernacle of the congregation before the LORD. And he shall put his hand upon the head of the burnt offering; and it shall be accepted for him to make atonement for him. And he shall kill the bullock before the LORD: and the priests, Aaron's sons, shall bring the blood, and sprinkle the blood round about upon the altar that is by the door of the tabernacle of the congregation. And he shall flay the burnt offering, and cut it into his pieces. And the sons of Aaron the priest shall put fire upon the altar, and lay the wood in order upon the fire: And the priests, Aaron's sons, shall lay the parts, the head, and the fat, in order upon the wood that is on the fire which is upon the altar: But his inwards and his legs shall he wash in water: and the priest shall burn all on the altar, to be a burnt sacrifice, an offering made by fire, of a sweet savour unto the LORD.
Leviticus 1:1-9
So which of these is the truth? Is the account in Leviticus 1 of God talking to Moses concerning burnt offerings, correct, or is Jeremiah right to say that God did NOT give any such command?
Or are we expected to just believe two mutually contradictory things simultaneously in order to believe that the Bible is the word of a god, and not a poorly edited and inconsistent collection of various writings of different people following different agenda at different times?
2. Thou shalt not make any graven image save what thou canst sell for profit and dividend for thine bankers and money-lenders.
3. Thou shalt serve the money-lenders and bankers for we are a greedy class and shall visit iniquity unto thee and thine children even unto the fourth generation if thou bowest not down before us, but we shall smile upon those who slip a bung into party funds (see the LORD Ashcroft of Belize if thou requirest anonimity)
4. Forgeth thou the Sabbath day for we can make more then than on most normal shopping days, and if the shop workers liketh it not, they canst joineth the other scum in the jobless scrap heap even unto the rest of their days, for they wanteth a day of rest and it shall be given...
5. Thou shalt not kill, save when using the bombs and bullets made by those who doth bung a wad into our bank account, yea, even through the Belize Slush Facility.
6. Thou shalt not commit adultery unless thou hast already fixed up a 'kiss and tell' deal with the Sun of Murdoch, or hath taken out an Super Injunction from the Court on High, and especially whilst thou art still in the Cabinet and doth lecture the common masses on morality and values of the family, lest they laugh at thee and call thee hypocrite.
7. Thou shalt steal only what thou may steal legally, and thou shall support any Law which allowth thou so to do. Remember thou what thou wentest into politics for.
8. Thou shalt not bear false witness against thy neighbour unless thou knowest thou can get away with it. Prepareth thou the ground well before thou dost try and have something on thy neighbour in case he cuts up rough and dobs thou in it too.
9. Thou shalt covet thy neighbours house if he hast a bigger one than thou, and thou shalt borrow more money than thou canst afford to repay from the money-lenders so thou canst have a bigger one.
10. Thou shalt covet thy neighbours wife, especially if she be a trophy, and his servants and his goods and thou shalt feel a failure in life if thou hath less than another man, for thou art indeed beneath comtempt for a man is worth the value of his possessions.
11. Thou shalt hold in comtempt all who labour and toil and especially those who careth for others and toil for the common good, for care and compassion are for softies and only those who have it not work for those who have, for this is the will of thy god.
Staroměstské nám (Old Town Square), Prague, Czechia
In Memory of the Victims of Communism
Wenceslas Square, Prague.
For those of us on the Marxist left in 1968 the "Prague Spring" and it's brutal suppression by a combined force of Eastern Block armies was a culture shock. These were formative years for me.
After the frank embarrassment of the suppression of the Hungarian uprising in 1956 we had looked to Alexander Dubček and the Czechoslavak liberal reformers to deliver us "Communism with a human face".
It occurred against a backdrop of world-wide condemnation of US involvement in Vietnam and the increasing popularity of the French and Italian Communist Parties with what seemed the real prospect of democratically elected Communist governments in two Western European countries and members of the Common Market (as the EU was then known). Student radical groups were becoming influential in France, Germany and Britain.
African leaders like Agostinho Neto and Samoral Machel were leading Marxist rebellions in Portugese colonies; even in America student radicals were politicising America's youth.
And of course the heroic people of South East Asia were beating back the advance of Western Imperialism and taking their countries back, led, naturally, by good Marxist-Leninists like Ho Chi Minh and the NLF.
The world seemed to be coming over to the next stage in human historical development exactly as Marxist theory told us was inevitable. 'Revolutionary situations' were arising everywhere we looked. The inevitable march of human history was gathering pace and time was on our side. We had nothing to lose but our chains; we had a world to win.
Then resurrected Stalinism intervened in Prague and put an end to all that.
And a brave young idealist, Jan Palach, burned himself to death in Wenceslas Square, followed a month later by Jan Zajíc, to show us what Communism was to those who lived it in real life.
I couldn't find a picture of the Taxicab Fallacy so here's a parrot to represent people who spout apologetic fallacies without thinking about them. Yes, I know it's not a parrot, it's a kestrel, but you can't use that error to prove it's not a parrot. Taxicab fallacy you see.
Taking up the theme of Christian 'logic' again, I was pondering on a comment, left on my blog "How Dan Destroys The Bible" by someone who, perhaps understandably, wants to remain anonymous.
"In no sense is an argument a valid one if it is built upon the accuracy of what it is arguing is inaccurate. If the bible is false, then those entries are false, and cannot, therefore be used as part of your argument to show that the bible is false. You've created a loop. If those entries are true, then the bible is true, therefore your argument is false."
I understand this is known as the "Taxicab Fallacy" and is a favourite of Christian apologist and genocide and child-murder defender, William Lane Craig. For an excellent blog on this see The Fallacy of the "Taxi Cab Fallacy" by Plasma Engineer.
I thought it might be fun to see what we can do with this device which Christians and Muslims try to use to overcome the embarrassment of having holy books supposedly written/inspired by omniscient gods but which contain mistakes of fact or reason.
Imagine you're in court charged with a crime of which you are completely innocent and the prosecution have put up a statement by an eye-witness as evidence against you. The statement says the crime was committed on a Tuesday afternoon by a 6 feet tall, 220 lbs (15 stone 12 lbs if you're not American) woman with red hair and one leg. Your defence has pointed out that you are a 5 feet 6 inch male with black hair and the full complement of legs, and that the crime was actually committed on a Friday morning.
"Ah!", Say the prosecution, "but you can't use the errors in the statement to prove the statement is false because in no sense is an argument a valid one if it is built upon the accuracy of what it is arguing is inaccurate. If the statement is false, then those entries are false, and cannot, therefore be used as part of your argument to show that the statement is false. Therefore you have no grounds for questioning the accuracy of the witness statement".
"Got a good point there!", says your defence lawyer. "Can't dispute that logic!"
I wonder if my anonymous contributor would put his hands up and admit he/she must be guilty in that case because the witness statement is obviously true, or whether he would fire his defence lawyer.
I'm wondering is this 'logic' is just confined to written words or if it applies to other faulty things. In the UK we have a consumer-protection law called the "Trade Descriptions Act" which makes it an offence to lie about goods offered for sale. For example, it is illegal to state that a food item contains fewer calories than it actually contains, or that a washing powder makes your children glow in the dark when it doesn't.
I wonder if a rogue trader could get away with arguing that you can't use these errors as proof that his descriptions were wrong and misleading because, if the description is false, then those entries are false, and cannot, therefore be used as part of your argument to show that the description is false. The description is therefore true and not misleading.
I think if I took my car to the local garage because the lights didn't work and was told that the lights must be working because you can't use the fault to prove there is a fault with the lights, I might well use another garage in future.
As we can see, religious apologists have no worries about using the tactics of false witnesses, rogue traders or cowboy mechanics to pull the wool over the eyes of their followers who seem to have so much wool between their ears that this is almost too easy to do.
Religion is an insult to human dignity. With or without it you would have good people doing good things and evil people doing evil things. But for good people to do evil things, that takes religion.
Steven Weinberg
Continuing my theme of religions giving permission to extremists, this is a collection of writing, pictures, cartoons, Twitter tweets and blogs in which religion is used to excuse and even advocate crimes against humanity such as violent persecution, genocide, mass murder against people with different beliefs or none. Things which any decent person with even a modicum of respect for their fellow human beings would look at and say, "That's wrong! And if your religion tells you it's right, your religion is wrong too."
It is an on-going project and will be added to as more material is gathered. Examples please.
First, a quote by the Christian apologist William Lane Craig, current darling of the US religious right who seems to have embarked recently on a campaign to make genocide and child mass-murder look like a Christian moral crusade (and I use that word deliberately). The full text may be read here.
According to the Pentateuch (the first five books of the Old Testament), when God called forth his people out of slavery in Egypt and back to the land of their forefathers, he directed them to kill all the Canaanite clans who were living in the land (Deut. 7.1-2; 20.16-18). The destruction was to be complete: every man, woman, and child was to be killed. The book of Joshua tells the story of Israel’s carrying out God’s command in city after city throughout Canaan...
So then what is Yahweh doing in commanding Israel’s armies to exterminate the Canaanite peoples? It is precisely because we have come to expect Yahweh to act justly and with compassion that we find these stories so difficult to understand. How can He command soldiers to slaughter children?...
I think that a good start at this problem is to enunciate our ethical theory that underlies our moral judgements. According to the version of divine command ethics which I’ve defended, our moral duties are constituted by the commands of a holy and loving God. Since God doesn’t issue commands to Himself, He has no moral duties to fulfill. He is certainly not subject to the same moral obligations and prohibitions that we are. For example, I have no right to take an innocent life. For me to do so would be murder. But God has no such prohibition. He can give and take life as He chooses...
So the problem isn’t that God ended the Canaanites’ lives. The problem is that He commanded the Israeli soldiers to end them. Isn’t that like commanding someone to commit murder? No, it’s not. Rather, since our moral duties are determined by God’s commands, it is commanding someone to do something which, in the absence of a divine command, would have been murder. The act was morally obligatory for the Israeli soldiers in virtue of God’s command, even though, had they undertaken it on their on initiative, it would have been wrong.
On divine command theory, then, God has the right to command an act, which, in the absence of a divine command, would have been sin, but which is now morally obligatory in virtue of that command...
But why take the lives of innocent children?... if we believe, as I do, that God’s grace is extended to those who die in infancy or as small children, the death of these children was actually their salvation. We are so wedded to an earthly, naturalistic perspective that we forget that those who die are happy to quit this earth for heaven’s incomparable joy. Therefore, God does these children no wrong in taking their lives.
So whom does God wrong in commanding the destruction of the Canaanites? Not the Canaanite adults, for they were corrupt and deserving of judgement. Not the children, for they inherit eternal life. So who is wronged? Ironically, I think the most difficult part of this whole debate is the apparent wrong done to the Israeli soldiers themselves. Can you imagine what it would be like to have to break into some house and kill a terrified woman and her children? The brutalizing effect on these Israeli soldiers is disturbing.
So here we have a leading Christian apologist telling those so inclined that genocide and child mass-murder is good and it's not their fault when they do it. They are merely obeying a god's command and carrying out its wishes. Why, it would almost amount to a sin; to moral failure even, NOT to kill people who don't share your religion. And don't worry about such scruples as finding child murder distasteful or shocking. It's all to the good, and anyway it's actually good for children - it makes them happy!
And if you're tempted not to believe it, here is William Lane Craig saying it:
Just obey those voices in your head (or more likely, the voices of the right-wing politicians and their dutifully obedient clerics who tell you a god told them to tell you) and you have no responsibilities for the consequences of your actions. You have this on the personal assurance of William Lane Craig - not that HE would do such a thing, of course.
Note the several examples of suggestible and inadequate individuals taking up this theme and now feeling part of a new, exciting movement, in the Twitter tweets defending William Lane Craig's repugnant apologetic. Christians expressing horror at it and taking Lane Craig to task are, naturally, as rare as hens' teeth.
This one illustrates how suggestible amateur apologists then proudly take up this theme, free from any feelings of guilt, on the grounds that anything a god orders is moral, regardless of the consequences, safe in the knowledge that this view is now 'respectable' and somehow reveals a new understanding and insight to be taken up with the zeal of a crusade.
Here we see Radovan Karadžić at his trial for war crimes, explaining how the Bosnian genocide in former Yugoslavia was good and 'holy'.
What are the odds that his comrade in arms, fellow Greek Orthodox Christians, Ratko Mladić offers up the same justification.
And of course, these people gave permission to, and even participated directly in, the atrocities following the break up of the former Yugoslavia.
"It's not a pleasant job, but somebody has to do it. It's all to the good in the end!"
I wonder how many guards and Kommandants at Treblinka, Dachau, Belson, Buchenwald and Sobibor said that.
Hence I believe I am acting in accordance with the will of the Almighty Creator: by defending myself against the Jew I am fighting for the work of the Lord.
Adolf Hitler
In this blog, (Tosin's Bible Blog) entitled "The Love Of God And Genocide" (No! Really!) also by a Christian we find people being compared to sick animals again, so genocide and child murder are equated to some sort of mercy killing; unpleasant but all to the long-term good. Even an act of love on the part of the perpetrator to whom we should be grateful and sympathetic.
"Not a pleasant job, but someone had to do it".
I guess most people would already know about the 6 million Jewish people killed through Nazism. This last statement is absolutely true, and I will research and post sources to corroborate it. However, this fact does not change the fact that yes, our loving God ordered these massacres, and yes, genocide is a very appropriate term for the massacres He ordered. How do we reconcile this with our faith?...
In the Bible, people are often compared to sheep. You know when the foot and mouth disease hit the UK, or in fact any contagious animal disease hits anywhere, culls of whole animal populations are ordered. Why? To stop the diseases spreading any further. Sometimes farmers are distraught at having to kill so many of their animals, yet everyone knows that if those animals were not killed, then even more animals would ultimately be lost. So it was with those cultures that God ordered to be destroyed. They were utterly saturated with the deadly and contagious illnesses of horrible sin. When foot and mouth strikes, you don’t say “Let’s spare the babies.” You have to systematically kill everything. And yet, the fact that a farmer kills so many of his animals does not mean that he does not love them, especially when he has carefully tended them and invested his very self into them. God invested His own image into all humanity. I know that this was a moral issue rather than a physical illness, so I sometimes think that surely, sometimes the children could have been spared, as they were too young to have imbibed the evil sinful practices and the attitudes of the adults. And in many cases children were spared. And yet in some cases God specifically commanded that even children – even animals were to be totally destroyed. I believe that in these passages God is using these civilisations as symbols for how sin has to be utterly destroyed. Remember that He is God, He is the Creator, He can do that.
My feelings as a Christian points me to my Lord and Savior as a fighter. It points me to the man who once in loneliness, surrounded by a few followers, recognized these Jews for what they were and summoned men to fight against them and who, God's truth! was greatest not as a sufferer but as a fighter. In boundless love as a Christian and as a man I read through the passage which tells us how the Lord at last rose in His might and seized the scourge to drive out of the Temple the brood of vipers and adders. How terrific was His fight for the world against the Jewish poison. To-day, after two thousand years, with deepest emotion I recognize more profoundly than ever before the fact that it was for this that He had to shed His blood upon the Cross. As a Christian I have no duty to allow myself to be cheated, but I have the duty to be a fighter for truth and justice... And if there is anything which could demonstrate that we are acting rightly it is the distress that daily grows. For as a Christian I have also a duty to my own people.
Adolf Hitler, 12 April 1922
Probably little more need be said about this nauseating blog save to point out that "Tosin" seems ignorant of much of history, or at least is hoping his readers are. From the style of writing it would appear that "Tosin" is very young so perhaps the interesting point here is how he/she has picked up the permission to commit genocide currently being promulgated by William Lane Craig and his acolytes.
I hope the relative of the victims of the Holocaust derive some comfort from the thought that their loved ones died as an act of mercy to prevent the rest of us catching their disease, and that their deaths were ordered by a 'loving' god for the good of humanity, or simply because he can.
Interestingly, the only comments to date (10 Dec 2011), apart from my own, have been from Christians complimenting Tosin and thanking him for helping them to reconcile genocide with a loving god. None of them have questioned whether acts of genocide done in its name could actually raise questions about its 'loving' nature, or its existence.
In this blog, entitled "Why does the Bible Condone Genocide" by Christian apologist John Hendryx, at least there is none of the nauseating equation of humans with diseased animals, nor the claim that killing them was good for them; that we're doing them a favour for which they should be grateful, actually.
Instead we are simply assured that the Christian god has the right to do what it wants with humans and just uses believers to carry out its tasks, so freeing them of personal responsibility for their crimes and allowing them the excuse of blaming them on a god. Anyway, they were going to die eventually, so what harm was there? The murderers were just doing their god's work, so are to be admired.
Obviously, to this school of Christian 'morality', human life is of little value, so long as it's someone else's life. Notions of human rights and human dignity are unknown. We are nothing more than the playthings of their capricious and mendacious god and killing people is simply hastening the inevitable a little.
Before we get to Canaan, consider this further point: not only may God take life as he sees fit – he does take the life of every last human on earth (see Heb. 9:27)."...
A couple more points may be helpful to keep the slaughter of the Canaanites in perspective: first, at that time in the OT, God had given the nation of Israel clear civil authority and responsibilities; and as a lawfully-ordained civil government, functioning directly under his control, He commanded them to carry out His just judgment against the idolaters of Canaan...
When it is a judicial act of a properly instituted civil government, taking a life may sometimes be warranted. Apparently, the slaughter of the Canaanites was one such judicial act, carried out by the magistrates of Israel.
Corpses piled up behind the crematorium in Buchenwald concentration camp, April 1945
So, it's also okay so long as it's done with the approval of the government. No doubt Ratko Mladic will be relieved to know that, though it's a point which, strangely, the jurists at Nuremberg failed to appreciate. It's also a point which those who formulated and signed the Geneva Convention seem to have missed.
"Just obeying orders, yer honour! Anyway, a god told me to do it!"
So we see how religions, which purport to sanctify and value human life, reduce it to a worthless thing, easily extinguished to satiate the blood-lust or territorial ambitions of their followers and to permit the actions they purport to condemn and abhor - when it's expedient so to do.
People who can believe the blood sacrifice of an innocent person can absolve them of personal responsibility for their own sins, have a low regard for life, it seems. Someone else's life only has a utility value to them.
This example of a wanabee genocidist sitting at home casually and anonymously calling for the murder of everyone who disagrees with him, illustrates the point rather nicely I think.
'Keith' clearly feels he has permission to call for this because it is for the good of society and even his patriotic duty (as long as someone else does it, no doubt). No need any longer to bother about such niceties as right and wrong or whether your superstition has any merit; just kill everyone and have done with it, then there won't be anyone to bother you with those annoying little questions.
And dress the whole thing up as a moral crusade. Nowhere in it is there any hint of valuing human life or consideration of human worth. It's all for me and only I matter.
And still they come, though this one is struggling to explain in exactly what context child murder and genocide are right for Christians. Will update when he's decided, if ever.
And the whole earth was of one language, and of one speech. And it came to pass, as they journeyed from the east, that they found a plain in the land of Shinar; and they dwelt there. And they said one to another, Go to, let us make brick, and burn them thoroughly. And they had brick for stone, and slime had they for morter. And they said, Go to, let us build us a city and a tower, whose top may reach unto heaven; and let us make us a name, lest we be scattered abroad upon the face of the whole earth.
And the LORD came down to see the city and the tower, which the children of men builded. And the LORD said, Behold, the people is one, and they have all one language; and this they begin to do: and now nothing will be restrained from them, which they have imagined to do. Go to, let us go down, and there confound their language, that they may not understand one another's speech.
So the LORD scattered them abroad from thence upon the face of all the earth: and they left off to build the city. Therefore is the name of it called Babel; because the LORD did there confound the language of all the earth: and from thence did the LORD scatter them abroad upon the face of all the earth.
Genesis 11:1-9
So, if this happened in the real world and the god described was an omniscient god, what would we expect to find? The god's clear intent was that people should not be able to understand one another, so we should see language groups rubbing shoulders on their borders with people who speak an entirely unrelated language. We would expect people speaking similar languages to be separated by great distances so that the chance of them coming up against people who could make a reasonable guess at what they were saying was virtually zero. We would expect to find people speaking a language similar to English to live in, say, South-east Asia or South America, and people who speak a language like Swedish to be found in Africa or Siberia. And of course, we would expect to find people speaking a Bantu language as far away from South Africa as possible, say in Canada, Norway or Australia.
Is this what we find?
Of course not. That's what the Bible predicts we should find so we can be fairly sure reality isn't going to be anything like that.
What we find is a reality about as far away from that as it's possible to get. We find precisely the opposite of what the Bible forecasts, of course.
I'll illustrate this with a few language maps I found with a few clicks on Google.
Well, that's the reality which, as we can see is a very different thing to the one we would expect if the myth of the Tower of Babel in the Bible was correct.
What we see in reality is exactly what we would expect to see if language is an evolving cultural thing which we inherit from our cultures and our parent generation along with our other memes. We see diversification occurring due to isolation for various reasons like political borders, isolating valleys and mountain ranges, different religions or religious sects, etc. We also see remnant populations of earlier language groups isolated within larger populations like the Basques of North-eastern Spain and South-western France.
Some years ago on a night shift, I had been reading Beowulf, the earliest known work in Early English, with translation, obviously. One of my assistants, who is Anglo-Norwegian and speaks both languages fluently as well as Danish, Swedish and German, picked it up with a half-dismissive, "what's this you're reading now?", then she said, "Hey! I can read this, almost! Why are you reading old Danish?" Of course she was right. Beowulf is no more English than it is Danish or Dutch. It was written in a language ancestral to, or at least close to one which was ancestral to Dutch and Danish and close to Swedish and Norwegian.
"Beowulf methelode, bearn Ecgtheowes; 'Hwaet, thu worn fela, wine win Unferth, beorne druncen, ymb Breccan spreace, suaegdest from his sithe. Soth ic talige thaet ic merestrengo maran ahte, aerfetho on ythum, thonne aenig other man.
[Beowulf spoke, the son of Ecgtheow: "Well, Unferth my friend, drunk with beer you have talked a great deal about Brecca, told of his adventures. I claim for a fact that I have greater strength in the sea, hardship of the waves, than any other man.]
One of my favourite language groups is the so-called Celtic groups found in the extreme edge of Western Europe. This group is split into two main groups: the Goedelic and Brythonic groups, also called p-Celtic and q-Celtic. They are the Irish and Scots Gaelic, and Welsh languages. They also include Manx (close to Irish Gaelic with some Welsh), Cornish, Breton from France and Galician from Spain (all close to Welsh). They are ancient languages, possibly related to the language spoken in Western Europe before the Roman conquest and maybe even to Cythian, though it's not at all certain that the modern Celts are the same people as the Keltoi, as the Greeks called them or the people the Romans called Gauls.
The terms p-Celtic and q-Celtic come from the ancient words for 'son of' or more precisely, 'of the clan of', map and maq in Welsh and Gaelic respectively. These have become the modern Ap (or Ab) in Welsh and Mac in Scots and Irish Gaelic. How many people today have the name Bevan (Ab Evan), Pritchard (Ap Richard) or Probert (Ap Robert) and how many millions of Macs and Mcs are there? So we can trace these family names back to early origins in earlier languages and to the culturally related device of using a clan name as a surname.
The Celtic word for king is also interesting. Forms of it appear in other related modern languages. It is words like this which show how languages are related. The Gaelic for king is rí. This word takes the form rex in Latin, roi in French and raj in Hindi and Urdu, so showing, along with many other words, how Gaelic, Latin and Hindi are all members of the Indo-European family of languages. From this word, (via medieval French) we get the English words Royal, Regal and Reign. Yes. We still speak a local dialect of Indo-European.
The distribution, differences and similarities of human languages is precisely what we would expect of something which evolved and is still evolving. It is exactly the opposite of what we would see it they had been been spontaneously created by an intelligent god, especially if the intention was to make it so people from neighbouring countries couldn't understand one another. Had the god of the Bible forgotten that people can learn to speak different languages?
Again, the disconnect between the Bible and reality is exposed with a brief look at reality.