Browsing casually through the KJV Bible today, I came across these curious passages.
According to Matthew, Jesus tells a tale about a wise man building his house on rock and a foolish man building it on sand. He then prophecies that a house built on rock won't fall down but one built on sand will.
Therefore whosoever heareth these sayings of mine, and doeth them, I will liken him unto a wise man, which built his house upon a rock: And the rain descended, and the floods came, and the winds blew, and beat upon that house; and it fell not: for it was founded upon a rock.
And every one that heareth these sayings of mine, and doeth them not, shall be likened unto a foolish man, which built his house upon the sand: And the rain descended, and the floods came, and the winds blew, and beat upon that house; and it fell: and great was the fall of it.
Matthew 7:24-27
Well, that's pretty obvious really. It doesn't take a genius to come to come up with that, does it?
But what's this a little later on?
Matthew then tells us this curious tale:
And Simon Peter answered and said, Thou art the Christ, the Son of the living God. And Jesus answered and said unto him, Blessed art thou, Simon Barjona: for flesh and blood hath not revealed it unto thee, but my Father which is in heaven. And I say also unto thee, That thou art Peter, and upon this rock I will build my church; and the gates of hell shall not prevail against it.
Matthew 16:16-18
Hmm... so Matthew has Jesus choosing Simon Barjona as the rock upon which to build his church. Note the use of the singular there; "my church", not "my churches". He also has Jesus prophesying that "the gates of hell shall not prevail against it". Again the singular 'it'.
But what happened to this church? How did that prophecy turn out?
Is there just one true church?
Clearly not. Apart from the major schisms between the Roman and Orthodox Church, there are also the earlier schisms between the Coptic, Armenian and Maronite Christian churches, the Cathars, the Paulicians, Lollards, Hussites, etc. Then of course the various other schisms like that between the Catholic and Protestant churches.
And then the storm really hit. The Protestant church almost immediately fragmented into all the various sects like Lutherans, Calvinists, Quakers, Presbyterian, Baptist, Anabaptist, Seventh Day Adventist, Methodist, Anglican or Episcopalian, etc, etc, etc, and the Baptist sect alone promptly shattered again into a myriad different churches so that today we have some 40,000 different churches, all claiming to be the one true church and, at least by implication, that all the others are false, and therefore Satanic.
Ravening Wolf
The One True Church Jesus built on Simon 'The Rock' Barjona has shattered like grains of sand, and the gates of hell seem to have prevailed against it, if you believe all the present churches, that is.
Curious how all these modern-day priests seem to want their 'flock' to believe that Jesus was a foolish man, a false prophet and a poor judge of character in his choice of Simon, and that the Gates of Hell have indeed triumphed over Jesus' church, eh?
Or was Matthew up to something when he made up those tales?
What's that you say, Matthew?
Beware of false prophets, which come to you in sheep's clothing, but inwardly they are ravening wolves.
Matthew 7:15
Hmm... so beware of Jesus, the ravening wolf clothed as a lamb, eh?
Blimey! Subversive, or what!? You'd have thought the Bible's editors would have picked that one up.
I'm glad I'm not a Christian so I don't have to work out ways to ignore this sort of hopeless muddle.
I heard an interesting thing today. At least I find it interesting.
Apparently, in the fifteenth century, Turkish traders started supplying England with the helmeted guinea fowl, Numida meleagris, a bird found wild in East Africa which had been domesticated there for about 4000 years and was so named because of the strange bony structure it has on its head.
It had been introduced by the Romans 1400 years earlier, but had been lost with the collapse of the Roman Empire.
These traders were known as Turkish or Turkey Traders and, by the sort of popular misunderstanding which helps create new words in a language, these birds became popularly known as turkeys. They were a popular meat at Christmas because they tasted good and had a fair amount of meat on them.
Later, when the distantly related wild bird, Meleagris gallopavo, now know as the turkey, was introduced from the New World, because it looked and tasted a bit like the 'turkey' it was mistakenly also called a turkey. As the helmeted guinea fowl fell out of favour, the name transferred to the New World bird.
So, a New World bird came to be known indirectly by the same name as a country with which it had absolutely no direct connection.
Like so much else with the European Yuletide, midwinter festival onto which the Christian Nativity myth has been grafted because the church couldn't bear being left out, turkeys have nothing to do with the Bible stories on which the myths are based.
Nor do holly, ivy, mistletoe, plum puddings, mince pies, dates, figs, the giving of gifts or even the season of goodwill to all men, wassailing and yule logs.
Go to any creationist website and you will find any number of 'creation scientist' explaining to their credulous and gullible readership and potential customers that information theory proves that no new information can arise by a random process, or some such half-baked notion, so the Theory of Evolution must be wrong (so a magic man magicked everything and it must have been the locally popular one, obviously, as eny fule kno).
Where do they get these ideas from?
Mutations in DNA are relatively common because the copying process is not perfect, despite the mechanisms which have evolved to correct them.
I'll not go into the so-called genetic code here because, with a few clicks on Google, or by opening any of very many books on the subject, this can be easily found by those who wish to know more. Those who don't won't have bothered reading this far.
If anyone can tell me why a mutation which changes the genetic code for a small portion of a given enzyme from, let's say, UUAUAUCAUGUAGAUAACCCCUGA to UUAUCUCAUGUAGAUAACCCCUGA in the short sequence of mRNA, is prohibited by the second law of thermodynamics, I'd be very grateful...
If the Judeo-Christian god want us to believe in him, why doesn't he:
Do to each of us what he allegedly did to Saul on the road to Damascus?
Become incarnate and perform public miracles at every generation, as he allegedly did to Moses and as Jesus?
Spontaneously appear and end a famine, stop a war, cure a disease or prevent a natural disaster?
Why didn't he:
Create a universe, solar system and life on earth in such a way that it is totally unexplainable by science, and leaving him as the only possible explanation above all other possible gods?
Create life on earth so that it cannot be explain by ideas of common descent and divergence; so that comparative anatomy and physiology can find no connections or similarities between different species; that there are no classes intermediate between fish and mammals, or similarities between humans and other life forms; that each species had an entirely different genetic code, or no code at all; with no fossil evidence suggesting an evolutionary process with regular extinctions?
Create a flat earth so it could not be logically explained any other way than by divine creation?
Create an earth with no geological evidence suggesting it is very old and has formed by a dynamic process over a very long time?
Created an earth with no evidence of unintelligent design?
Created a monument to Abraham which could be accurately dated?
Arranged for there to be archaeological and independent historical evidence of the Exodus, the wandering of the Israelites in Sinai, the destruction of the Canaanites, the massive economic collapse of Egypt following the plagues and the loss of it's slave population, etc?
Left unarguable evidence of a universal flood and made remains of Noah's Ark easy to find and validate?
Why doesn't he:
Make Christians nicer people who actually do what they tell others they should do?
Answer prayers in ways too obvious to be disputed, making Christians people we can go to to get our problems sorted by prayer?
Produce evidence that prayer works so that scientific studies would always show overwhelming evidence of their efficacy?
Create a single, world-wide religion?
Predict future events precisely so that we can see clearly the validity of the prediction?
Create a religion which, unlike all other known religions, is not disbelieved by a majority of the world's people?
In short, why doesn't the Judeo-Christian god seem to want people to believe in him?
Thus saith the LORD of hosts, the God of Israel; Put your burnt offerings unto your sacrifices, and eat flesh. For I spake not unto your fathers, nor commanded them in the day that I brought them out of the land of Egypt, concerning burnt offerings or sacrifices: But this thing commanded I them, saying, Obey my voice, and I will be your God, and ye shall be my people: and walk ye in all the ways that I have commanded you, that it may be well unto you.
Jeremiah 7: 21-23
And the LORD called unto Moses, and spake unto him out of the tabernacle of the congregation, saying, Speak unto the children of Israel, and say unto them, If any man of you bring an offering unto the LORD, ye shall bring your offering of the cattle, even of the herd, and of the flock. If his offering be a burnt sacrifice of the herd, let him offer a male without blemish: he shall offer it of his own voluntary will at the door of the tabernacle of the congregation before the LORD. And he shall put his hand upon the head of the burnt offering; and it shall be accepted for him to make atonement for him. And he shall kill the bullock before the LORD: and the priests, Aaron's sons, shall bring the blood, and sprinkle the blood round about upon the altar that is by the door of the tabernacle of the congregation. And he shall flay the burnt offering, and cut it into his pieces. And the sons of Aaron the priest shall put fire upon the altar, and lay the wood in order upon the fire: And the priests, Aaron's sons, shall lay the parts, the head, and the fat, in order upon the wood that is on the fire which is upon the altar: But his inwards and his legs shall he wash in water: and the priest shall burn all on the altar, to be a burnt sacrifice, an offering made by fire, of a sweet savour unto the LORD.
Leviticus 1:1-9
So which of these is the truth? Is the account in Leviticus 1 of God talking to Moses concerning burnt offerings, correct, or is Jeremiah right to say that God did NOT give any such command?
Or are we expected to just believe two mutually contradictory things simultaneously in order to believe that the Bible is the word of a god, and not a poorly edited and inconsistent collection of various writings of different people following different agenda at different times?
2. Thou shalt not make any graven image save what thou canst sell for profit and dividend for thine bankers and money-lenders.
3. Thou shalt serve the money-lenders and bankers for we are a greedy class and shall visit iniquity unto thee and thine children even unto the fourth generation if thou bowest not down before us, but we shall smile upon those who slip a bung into party funds (see the LORD Ashcroft of Belize if thou requirest anonimity)
4. Forgeth thou the Sabbath day for we can make more then than on most normal shopping days, and if the shop workers liketh it not, they canst joineth the other scum in the jobless scrap heap even unto the rest of their days, for they wanteth a day of rest and it shall be given...
5. Thou shalt not kill, save when using the bombs and bullets made by those who doth bung a wad into our bank account, yea, even through the Belize Slush Facility.
6. Thou shalt not commit adultery unless thou hast already fixed up a 'kiss and tell' deal with the Sun of Murdoch, or hath taken out an Super Injunction from the Court on High, and especially whilst thou art still in the Cabinet and doth lecture the common masses on morality and values of the family, lest they laugh at thee and call thee hypocrite.
7. Thou shalt steal only what thou may steal legally, and thou shall support any Law which allowth thou so to do. Remember thou what thou wentest into politics for.
8. Thou shalt not bear false witness against thy neighbour unless thou knowest thou can get away with it. Prepareth thou the ground well before thou dost try and have something on thy neighbour in case he cuts up rough and dobs thou in it too.
9. Thou shalt covet thy neighbours house if he hast a bigger one than thou, and thou shalt borrow more money than thou canst afford to repay from the money-lenders so thou canst have a bigger one.
10. Thou shalt covet thy neighbours wife, especially if she be a trophy, and his servants and his goods and thou shalt feel a failure in life if thou hath less than another man, for thou art indeed beneath comtempt for a man is worth the value of his possessions.
11. Thou shalt hold in comtempt all who labour and toil and especially those who careth for others and toil for the common good, for care and compassion are for softies and only those who have it not work for those who have, for this is the will of thy god.
Staroměstské nám (Old Town Square), Prague, Czechia
In Memory of the Victims of Communism
Wenceslas Square, Prague.
For those of us on the Marxist left in 1968 the "Prague Spring" and it's brutal suppression by a combined force of Eastern Block armies was a culture shock. These were formative years for me.
After the frank embarrassment of the suppression of the Hungarian uprising in 1956 we had looked to Alexander Dubček and the Czechoslavak liberal reformers to deliver us "Communism with a human face".
It occurred against a backdrop of world-wide condemnation of US involvement in Vietnam and the increasing popularity of the French and Italian Communist Parties with what seemed the real prospect of democratically elected Communist governments in two Western European countries and members of the Common Market (as the EU was then known). Student radical groups were becoming influential in France, Germany and Britain.
African leaders like Agostinho Neto and Samoral Machel were leading Marxist rebellions in Portugese colonies; even in America student radicals were politicising America's youth.
And of course the heroic people of South East Asia were beating back the advance of Western Imperialism and taking their countries back, led, naturally, by good Marxist-Leninists like Ho Chi Minh and the NLF.
The world seemed to be coming over to the next stage in human historical development exactly as Marxist theory told us was inevitable. 'Revolutionary situations' were arising everywhere we looked. The inevitable march of human history was gathering pace and time was on our side. We had nothing to lose but our chains; we had a world to win.
Then resurrected Stalinism intervened in Prague and put an end to all that.
And a brave young idealist, Jan Palach, burned himself to death in Wenceslas Square, followed a month later by Jan Zajíc, to show us what Communism was to those who lived it in real life.
I couldn't find a picture of the Taxicab Fallacy so here's a parrot to represent people who spout apologetic fallacies without thinking about them. Yes, I know it's not a parrot, it's a kestrel, but you can't use that error to prove it's not a parrot. Taxicab fallacy you see.
Taking up the theme of Christian 'logic' again, I was pondering on a comment, left on my blog "How Dan Destroys The Bible" by someone who, perhaps understandably, wants to remain anonymous.
"In no sense is an argument a valid one if it is built upon the accuracy of what it is arguing is inaccurate. If the bible is false, then those entries are false, and cannot, therefore be used as part of your argument to show that the bible is false. You've created a loop. If those entries are true, then the bible is true, therefore your argument is false."
I understand this is known as the "Taxicab Fallacy" and is a favourite of Christian apologist and genocide and child-murder defender, William Lane Craig. For an excellent blog on this see The Fallacy of the "Taxi Cab Fallacy" by Plasma Engineer.
I thought it might be fun to see what we can do with this device which Christians and Muslims try to use to overcome the embarrassment of having holy books supposedly written/inspired by omniscient gods but which contain mistakes of fact or reason.
Imagine you're in court charged with a crime of which you are completely innocent and the prosecution have put up a statement by an eye-witness as evidence against you. The statement says the crime was committed on a Tuesday afternoon by a 6 feet tall, 220 lbs (15 stone 12 lbs if you're not American) woman with red hair and one leg. Your defence has pointed out that you are a 5 feet 6 inch male with black hair and the full complement of legs, and that the crime was actually committed on a Friday morning.
"Ah!", Say the prosecution, "but you can't use the errors in the statement to prove the statement is false because in no sense is an argument a valid one if it is built upon the accuracy of what it is arguing is inaccurate. If the statement is false, then those entries are false, and cannot, therefore be used as part of your argument to show that the statement is false. Therefore you have no grounds for questioning the accuracy of the witness statement".
"Got a good point there!", says your defence lawyer. "Can't dispute that logic!"
I wonder if my anonymous contributor would put his hands up and admit he/she must be guilty in that case because the witness statement is obviously true, or whether he would fire his defence lawyer.
I'm wondering is this 'logic' is just confined to written words or if it applies to other faulty things. In the UK we have a consumer-protection law called the "Trade Descriptions Act" which makes it an offence to lie about goods offered for sale. For example, it is illegal to state that a food item contains fewer calories than it actually contains, or that a washing powder makes your children glow in the dark when it doesn't.
I wonder if a rogue trader could get away with arguing that you can't use these errors as proof that his descriptions were wrong and misleading because, if the description is false, then those entries are false, and cannot, therefore be used as part of your argument to show that the description is false. The description is therefore true and not misleading.
I think if I took my car to the local garage because the lights didn't work and was told that the lights must be working because you can't use the fault to prove there is a fault with the lights, I might well use another garage in future.
As we can see, religious apologists have no worries about using the tactics of false witnesses, rogue traders or cowboy mechanics to pull the wool over the eyes of their followers who seem to have so much wool between their ears that this is almost too easy to do.
Religion is an insult to human dignity. With or without it you would have good people doing good things and evil people doing evil things. But for good people to do evil things, that takes religion.
Steven Weinberg
Continuing my theme of religions giving permission to extremists, this is a collection of writing, pictures, cartoons, Twitter tweets and blogs in which religion is used to excuse and even advocate crimes against humanity such as violent persecution, genocide, mass murder against people with different beliefs or none. Things which any decent person with even a modicum of respect for their fellow human beings would look at and say, "That's wrong! And if your religion tells you it's right, your religion is wrong too."
It is an on-going project and will be added to as more material is gathered. Examples please.
First, a quote by the Christian apologist William Lane Craig, current darling of the US religious right who seems to have embarked recently on a campaign to make genocide and child mass-murder look like a Christian moral crusade (and I use that word deliberately). The full text may be read here.
According to the Pentateuch (the first five books of the Old Testament), when God called forth his people out of slavery in Egypt and back to the land of their forefathers, he directed them to kill all the Canaanite clans who were living in the land (Deut. 7.1-2; 20.16-18). The destruction was to be complete: every man, woman, and child was to be killed. The book of Joshua tells the story of Israel’s carrying out God’s command in city after city throughout Canaan...
So then what is Yahweh doing in commanding Israel’s armies to exterminate the Canaanite peoples? It is precisely because we have come to expect Yahweh to act justly and with compassion that we find these stories so difficult to understand. How can He command soldiers to slaughter children?...
I think that a good start at this problem is to enunciate our ethical theory that underlies our moral judgements. According to the version of divine command ethics which I’ve defended, our moral duties are constituted by the commands of a holy and loving God. Since God doesn’t issue commands to Himself, He has no moral duties to fulfill. He is certainly not subject to the same moral obligations and prohibitions that we are. For example, I have no right to take an innocent life. For me to do so would be murder. But God has no such prohibition. He can give and take life as He chooses...
So the problem isn’t that God ended the Canaanites’ lives. The problem is that He commanded the Israeli soldiers to end them. Isn’t that like commanding someone to commit murder? No, it’s not. Rather, since our moral duties are determined by God’s commands, it is commanding someone to do something which, in the absence of a divine command, would have been murder. The act was morally obligatory for the Israeli soldiers in virtue of God’s command, even though, had they undertaken it on their on initiative, it would have been wrong.
On divine command theory, then, God has the right to command an act, which, in the absence of a divine command, would have been sin, but which is now morally obligatory in virtue of that command...
But why take the lives of innocent children?... if we believe, as I do, that God’s grace is extended to those who die in infancy or as small children, the death of these children was actually their salvation. We are so wedded to an earthly, naturalistic perspective that we forget that those who die are happy to quit this earth for heaven’s incomparable joy. Therefore, God does these children no wrong in taking their lives.
So whom does God wrong in commanding the destruction of the Canaanites? Not the Canaanite adults, for they were corrupt and deserving of judgement. Not the children, for they inherit eternal life. So who is wronged? Ironically, I think the most difficult part of this whole debate is the apparent wrong done to the Israeli soldiers themselves. Can you imagine what it would be like to have to break into some house and kill a terrified woman and her children? The brutalizing effect on these Israeli soldiers is disturbing.
So here we have a leading Christian apologist telling those so inclined that genocide and child mass-murder is good and it's not their fault when they do it. They are merely obeying a god's command and carrying out its wishes. Why, it would almost amount to a sin; to moral failure even, NOT to kill people who don't share your religion. And don't worry about such scruples as finding child murder distasteful or shocking. It's all to the good, and anyway it's actually good for children - it makes them happy!
And if you're tempted not to believe it, here is William Lane Craig saying it:
Just obey those voices in your head (or more likely, the voices of the right-wing politicians and their dutifully obedient clerics who tell you a god told them to tell you) and you have no responsibilities for the consequences of your actions. You have this on the personal assurance of William Lane Craig - not that HE would do such a thing, of course.
Note the several examples of suggestible and inadequate individuals taking up this theme and now feeling part of a new, exciting movement, in the Twitter tweets defending William Lane Craig's repugnant apologetic. Christians expressing horror at it and taking Lane Craig to task are, naturally, as rare as hens' teeth.
This one illustrates how suggestible amateur apologists then proudly take up this theme, free from any feelings of guilt, on the grounds that anything a god orders is moral, regardless of the consequences, safe in the knowledge that this view is now 'respectable' and somehow reveals a new understanding and insight to be taken up with the zeal of a crusade.
Here we see Radovan Karadžić at his trial for war crimes, explaining how the Bosnian genocide in former Yugoslavia was good and 'holy'.
What are the odds that his comrade in arms, fellow Greek Orthodox Christians, Ratko Mladić offers up the same justification.
And of course, these people gave permission to, and even participated directly in, the atrocities following the break up of the former Yugoslavia.
"It's not a pleasant job, but somebody has to do it. It's all to the good in the end!"
I wonder how many guards and Kommandants at Treblinka, Dachau, Belson, Buchenwald and Sobibor said that.
Hence I believe I am acting in accordance with the will of the Almighty Creator: by defending myself against the Jew I am fighting for the work of the Lord.
Adolf Hitler
In this blog, (Tosin's Bible Blog) entitled "The Love Of God And Genocide" (No! Really!) also by a Christian we find people being compared to sick animals again, so genocide and child murder are equated to some sort of mercy killing; unpleasant but all to the long-term good. Even an act of love on the part of the perpetrator to whom we should be grateful and sympathetic.
"Not a pleasant job, but someone had to do it".
I guess most people would already know about the 6 million Jewish people killed through Nazism. This last statement is absolutely true, and I will research and post sources to corroborate it. However, this fact does not change the fact that yes, our loving God ordered these massacres, and yes, genocide is a very appropriate term for the massacres He ordered. How do we reconcile this with our faith?...
In the Bible, people are often compared to sheep. You know when the foot and mouth disease hit the UK, or in fact any contagious animal disease hits anywhere, culls of whole animal populations are ordered. Why? To stop the diseases spreading any further. Sometimes farmers are distraught at having to kill so many of their animals, yet everyone knows that if those animals were not killed, then even more animals would ultimately be lost. So it was with those cultures that God ordered to be destroyed. They were utterly saturated with the deadly and contagious illnesses of horrible sin. When foot and mouth strikes, you don’t say “Let’s spare the babies.” You have to systematically kill everything. And yet, the fact that a farmer kills so many of his animals does not mean that he does not love them, especially when he has carefully tended them and invested his very self into them. God invested His own image into all humanity. I know that this was a moral issue rather than a physical illness, so I sometimes think that surely, sometimes the children could have been spared, as they were too young to have imbibed the evil sinful practices and the attitudes of the adults. And in many cases children were spared. And yet in some cases God specifically commanded that even children – even animals were to be totally destroyed. I believe that in these passages God is using these civilisations as symbols for how sin has to be utterly destroyed. Remember that He is God, He is the Creator, He can do that.
My feelings as a Christian points me to my Lord and Savior as a fighter. It points me to the man who once in loneliness, surrounded by a few followers, recognized these Jews for what they were and summoned men to fight against them and who, God's truth! was greatest not as a sufferer but as a fighter. In boundless love as a Christian and as a man I read through the passage which tells us how the Lord at last rose in His might and seized the scourge to drive out of the Temple the brood of vipers and adders. How terrific was His fight for the world against the Jewish poison. To-day, after two thousand years, with deepest emotion I recognize more profoundly than ever before the fact that it was for this that He had to shed His blood upon the Cross. As a Christian I have no duty to allow myself to be cheated, but I have the duty to be a fighter for truth and justice... And if there is anything which could demonstrate that we are acting rightly it is the distress that daily grows. For as a Christian I have also a duty to my own people.
Adolf Hitler, 12 April 1922
Probably little more need be said about this nauseating blog save to point out that "Tosin" seems ignorant of much of history, or at least is hoping his readers are. From the style of writing it would appear that "Tosin" is very young so perhaps the interesting point here is how he/she has picked up the permission to commit genocide currently being promulgated by William Lane Craig and his acolytes.
I hope the relative of the victims of the Holocaust derive some comfort from the thought that their loved ones died as an act of mercy to prevent the rest of us catching their disease, and that their deaths were ordered by a 'loving' god for the good of humanity, or simply because he can.
Interestingly, the only comments to date (10 Dec 2011), apart from my own, have been from Christians complimenting Tosin and thanking him for helping them to reconcile genocide with a loving god. None of them have questioned whether acts of genocide done in its name could actually raise questions about its 'loving' nature, or its existence.
In this blog, entitled "Why does the Bible Condone Genocide" by Christian apologist John Hendryx, at least there is none of the nauseating equation of humans with diseased animals, nor the claim that killing them was good for them; that we're doing them a favour for which they should be grateful, actually.
Instead we are simply assured that the Christian god has the right to do what it wants with humans and just uses believers to carry out its tasks, so freeing them of personal responsibility for their crimes and allowing them the excuse of blaming them on a god. Anyway, they were going to die eventually, so what harm was there? The murderers were just doing their god's work, so are to be admired.
Obviously, to this school of Christian 'morality', human life is of little value, so long as it's someone else's life. Notions of human rights and human dignity are unknown. We are nothing more than the playthings of their capricious and mendacious god and killing people is simply hastening the inevitable a little.
Before we get to Canaan, consider this further point: not only may God take life as he sees fit – he does take the life of every last human on earth (see Heb. 9:27)."...
A couple more points may be helpful to keep the slaughter of the Canaanites in perspective: first, at that time in the OT, God had given the nation of Israel clear civil authority and responsibilities; and as a lawfully-ordained civil government, functioning directly under his control, He commanded them to carry out His just judgment against the idolaters of Canaan...
When it is a judicial act of a properly instituted civil government, taking a life may sometimes be warranted. Apparently, the slaughter of the Canaanites was one such judicial act, carried out by the magistrates of Israel.
Corpses piled up behind the crematorium in Buchenwald concentration camp, April 1945
So, it's also okay so long as it's done with the approval of the government. No doubt Ratko Mladic will be relieved to know that, though it's a point which, strangely, the jurists at Nuremberg failed to appreciate. It's also a point which those who formulated and signed the Geneva Convention seem to have missed.
"Just obeying orders, yer honour! Anyway, a god told me to do it!"
So we see how religions, which purport to sanctify and value human life, reduce it to a worthless thing, easily extinguished to satiate the blood-lust or territorial ambitions of their followers and to permit the actions they purport to condemn and abhor - when it's expedient so to do.
People who can believe the blood sacrifice of an innocent person can absolve them of personal responsibility for their own sins, have a low regard for life, it seems. Someone else's life only has a utility value to them.
This example of a wanabee genocidist sitting at home casually and anonymously calling for the murder of everyone who disagrees with him, illustrates the point rather nicely I think.
'Keith' clearly feels he has permission to call for this because it is for the good of society and even his patriotic duty (as long as someone else does it, no doubt). No need any longer to bother about such niceties as right and wrong or whether your superstition has any merit; just kill everyone and have done with it, then there won't be anyone to bother you with those annoying little questions.
And dress the whole thing up as a moral crusade. Nowhere in it is there any hint of valuing human life or consideration of human worth. It's all for me and only I matter.
And still they come, though this one is struggling to explain in exactly what context child murder and genocide are right for Christians. Will update when he's decided, if ever.
And the whole earth was of one language, and of one speech. And it came to pass, as they journeyed from the east, that they found a plain in the land of Shinar; and they dwelt there. And they said one to another, Go to, let us make brick, and burn them thoroughly. And they had brick for stone, and slime had they for morter. And they said, Go to, let us build us a city and a tower, whose top may reach unto heaven; and let us make us a name, lest we be scattered abroad upon the face of the whole earth.
And the LORD came down to see the city and the tower, which the children of men builded. And the LORD said, Behold, the people is one, and they have all one language; and this they begin to do: and now nothing will be restrained from them, which they have imagined to do. Go to, let us go down, and there confound their language, that they may not understand one another's speech.
So the LORD scattered them abroad from thence upon the face of all the earth: and they left off to build the city. Therefore is the name of it called Babel; because the LORD did there confound the language of all the earth: and from thence did the LORD scatter them abroad upon the face of all the earth.
Genesis 11:1-9
So, if this happened in the real world and the god described was an omniscient god, what would we expect to find? The god's clear intent was that people should not be able to understand one another, so we should see language groups rubbing shoulders on their borders with people who speak an entirely unrelated language. We would expect people speaking similar languages to be separated by great distances so that the chance of them coming up against people who could make a reasonable guess at what they were saying was virtually zero. We would expect to find people speaking a language similar to English to live in, say, South-east Asia or South America, and people who speak a language like Swedish to be found in Africa or Siberia. And of course, we would expect to find people speaking a Bantu language as far away from South Africa as possible, say in Canada, Norway or Australia.
Is this what we find?
Of course not. That's what the Bible predicts we should find so we can be fairly sure reality isn't going to be anything like that.
What we find is a reality about as far away from that as it's possible to get. We find precisely the opposite of what the Bible forecasts, of course.
I'll illustrate this with a few language maps I found with a few clicks on Google.
Well, that's the reality which, as we can see is a very different thing to the one we would expect if the myth of the Tower of Babel in the Bible was correct.
What we see in reality is exactly what we would expect to see if language is an evolving cultural thing which we inherit from our cultures and our parent generation along with our other memes. We see diversification occurring due to isolation for various reasons like political borders, isolating valleys and mountain ranges, different religions or religious sects, etc. We also see remnant populations of earlier language groups isolated within larger populations like the Basques of North-eastern Spain and South-western France.
Some years ago on a night shift, I had been reading Beowulf, the earliest known work in Early English, with translation, obviously. One of my assistants, who is Anglo-Norwegian and speaks both languages fluently as well as Danish, Swedish and German, picked it up with a half-dismissive, "what's this you're reading now?", then she said, "Hey! I can read this, almost! Why are you reading old Danish?" Of course she was right. Beowulf is no more English than it is Danish or Dutch. It was written in a language ancestral to, or at least close to one which was ancestral to Dutch and Danish and close to Swedish and Norwegian.
"Beowulf methelode, bearn Ecgtheowes; 'Hwaet, thu worn fela, wine win Unferth, beorne druncen, ymb Breccan spreace, suaegdest from his sithe. Soth ic talige thaet ic merestrengo maran ahte, aerfetho on ythum, thonne aenig other man.
[Beowulf spoke, the son of Ecgtheow: "Well, Unferth my friend, drunk with beer you have talked a great deal about Brecca, told of his adventures. I claim for a fact that I have greater strength in the sea, hardship of the waves, than any other man.]
One of my favourite language groups is the so-called Celtic groups found in the extreme edge of Western Europe. This group is split into two main groups: the Goedelic and Brythonic groups, also called p-Celtic and q-Celtic. They are the Irish and Scots Gaelic, and Welsh languages. They also include Manx (close to Irish Gaelic with some Welsh), Cornish, Breton from France and Galician from Spain (all close to Welsh). They are ancient languages, possibly related to the language spoken in Western Europe before the Roman conquest and maybe even to Cythian, though it's not at all certain that the modern Celts are the same people as the Keltoi, as the Greeks called them or the people the Romans called Gauls.
The terms p-Celtic and q-Celtic come from the ancient words for 'son of' or more precisely, 'of the clan of', map and maq in Welsh and Gaelic respectively. These have become the modern Ap (or Ab) in Welsh and Mac in Scots and Irish Gaelic. How many people today have the name Bevan (Ab Evan), Pritchard (Ap Richard) or Probert (Ap Robert) and how many millions of Macs and Mcs are there? So we can trace these family names back to early origins in earlier languages and to the culturally related device of using a clan name as a surname.
The Celtic word for king is also interesting. Forms of it appear in other related modern languages. It is words like this which show how languages are related. The Gaelic for king is rí. This word takes the form rex in Latin, roi in French and raj in Hindi and Urdu, so showing, along with many other words, how Gaelic, Latin and Hindi are all members of the Indo-European family of languages. From this word, (via medieval French) we get the English words Royal, Regal and Reign. Yes. We still speak a local dialect of Indo-European.
The distribution, differences and similarities of human languages is precisely what we would expect of something which evolved and is still evolving. It is exactly the opposite of what we would see it they had been been spontaneously created by an intelligent god, especially if the intention was to make it so people from neighbouring countries couldn't understand one another. Had the god of the Bible forgotten that people can learn to speak different languages?
Again, the disconnect between the Bible and reality is exposed with a brief look at reality.
In the Bible we find a strange world... And it is indeed strange to us today - very strange.
We find a world where a snake and a donkey talked, where giants lived in the land, where people could live to nine-hundred-plus years old, where a woman was turned into a pillar of salt, where a pillar of fire could lead people by night, where the sun stopped moving across the sky or could even back up, where a star could point down to a specific home, where people could instantly speak in unlearned foreign languages, and where someone's shadow or handkerchief could heal people.
It is a world where a flood could cover the whole earth, and where a man could walk on water, calm a stormy sea, change water into wine, or be swallowed by a "great fish" and live to tell about it. It is a world populated by demons that could wreak havoc on earth and also make people very sick. It is a world of idol worship, where human and animal sacrifice pleased God. In this world we find visions, inspired dreams, prophetic utterances, miracle workers, magicians, diviners, and sorcerers. It is a world where God lived in the sky (heaven) and people who died went to live in the dark recesses of the earth (Sheol)...
The world is viewed as a three-storied structure with the earth in the centre, the heaven above, and the underworld beneath. Heaven is the abode of God and celestial beings - angels. The underworld is hell, the place of torment. Man is not in control of his life. Evil spirits may take possession of him. Satan may inspire him with evil thoughts.
It is simply the cosmology of a prescientific age.
Bible literalists hold this book to be the best description of the real world, far surpassing for accuracy, reliability and usefulness anything modern science can produce.
The problem with all the exclusive monotheist religions is that they have a ‘holy’ book which can’t be questioned or disputed. They have a book which they believe contains the holy words of their god as revealed through divinely inspired ‘prophets’.
So it must be true; all of it; without question or doubt.
There is no moderate position possible over this. All truth was revealed by an omniscient god in that book and those truths are eternal. It is not for mere mortals to dispute those truths.
To not believe the Bible, Qur'an, Talmud or The Guru Granth Sahib is to leave the 'faith'; to cease to be a Christian, Muslim, Jew or Sikh.
The best a moderate can do when confronted with something so grotesquely and obviously wrong as ordering genocide or child murder; of permitting rape; of relegating women to subservient chattel status; of encouraging racism and slavery and cultural supremacy, is to try to explain it away as situational, out of context, allegorical, justified ONLY in the special circumstances pertaining at that time (which, incidentally, merely begs the question of just why it was included in the book in the first place), etc, etc.
Moderates claim to be able to discern a message different to the one given in the holy book whilst never acknowledging that the message was wrong in the first place and could not have been the work of a loving, merciful, just and benevolent god.
By defending the inerrancy of the god which inspired the book and the inerrancy and perfection of its message; by explaining away any reason to doubt or question the basic tenets of the ‘faith’ believers derive from the book, moderates grant permission to extremists.
So whom does God wrong in commanding the destruction of the Canaanites? Not the Canaanite adults, for they were corrupt and deserving of judgement. Not the children, for they inherit eternal life. So who is wronged? Ironically, I think the most difficult part of this whole debate is the apparent wrong done to the Israeli soldiers themselves. Can you imagine what it would be like to have to break into some house and kill a terrified woman and her children? The brutalizing effect on these Israeli soldiers is disturbing.
Extremists read exactly the same words and see this inerrant and perfect god inerrantly telling them to kill those who disagree with them; even to heroically kill themselves to do so, sure in the certain knowledge that they will be rewarded by the inerrant and loving god which told them to do such things.
Extremists read exactly the same words and see this inerrant and perfect god inerrantly telling them that it created the universe and life on it in just seven days, and that all humans have been contaminated by 'sin' and need to spend their lives abjectly apologizing and begging for forgiveness for something they had no control over and which, if it was done at all, was done many thousands of years ago.
And so they have permission to tell their unfortunate children, and anyone else's children, that they are unworthy sinners who need to grovel in abject subservience to this god who will inflict eternal torture and torment on them for even daring to think it might not be all true.
Extremists read exactly the same words and see this inerrant and perfect god inerrantly telling them that what they can see in the physical evidence all around them is wrong and so they have permission to insist their children not be taught science but be taught a primitive mythology instead; that their understanding of the universe should never be permitted to rise above that of Bronze Age marauders whose 'science' was such that they hadn't even invented the wheel and believe the earth was flat, had a dome over it with holes in as stars, and stood at the centre of a very small universe.
Extremists read exactly the same words and see a perfect god telling them to kill their sister or daughter if she 'dishonours' the family. They read these same words and see a perfect god telling them to behead unbelievers. They see a perfect good telling them all other peoples and religions and anyone who disagrees with them are wrong and are working for Satan in the name of evil, to be vigorously opposed by all means available, including persecution, dispossession, torture and genocide.
And they have permission granted them by the moderates to do these things in the name of a religion which the moderates have told them they can't question and for a god the moderates have told them is inerrant and perfect and indeed inspired the prophets to write the book they read. The same moderates who have defended, in the name of freedom of conscience, their right to hold their beliefs and to practice their 'faith' free from the sanctions a decent society normally applies to its anti-social miscreants.
Moderates grant permission to the extremists to use their 'faith' as an excuse for their antisocial behavior and an excuse for their demands to be given control over the lives of others.
The only real difference between a moderate and an extremist is the moderates assume their god couldn’t really have meant those despicable things and so must have meant something else, whilst, of course, still being inerrant and omniscient. Extremist have no such doubts.
Tolerating the intolerant and granting them the right to try to take away our freedoms is playing into their hands. You can be sure they would quickly deny us the same tolerance and freedoms they demand for themselves if they ever form a theocracy. The evidence of history is that no unrestrained theocracy has ever been tolerant of dissenters. All unrestrained theocracies have used their power not to improve the lot of the people but to restrain and control them and reverse centuries of social, cultural and economic progress back to some assumed dream time in the Bronze Age.
The support of theocrats for the idea of freedom of religion is inversely proportional to their strength in society. Once they gain power, support for other people's freedom of religion melts away like a thief in the night.
When it comes down to it, all the arguments Creationists put up against science because it disagrees with the Bible or the Qur'an are really arguments that their god only told the truth in their favourite holy book, so anything which disagrees with it must be false - including all the evidence they believe their god created in the universe.
Creationists deny the age of the universe, which requires them to believe their god lied when it placed all the photons so the universe just looks 14 billion years old, it lied again in the red shift so it just looks as though the universe has been expanding for 14 billion years and it lied again in the background microwave radiation which is just as it would be if the universe was 14billion years old and started off as a singularity of almost infinite density.
Creationists deny the age of earth, which requires them to believe their god lied in all the geological evidence which just makes the earth look 4 billion years old.
Creationist deny that life on earth evolved from a common ancestor which existed some 3.5 billion years ago, which requires them to believe their god lied in all the genetic, immunological, palaeontological and morphological evidence which shows a 'tree of life' exactly as it would appear if life evolved from a common ancestor 3.5 billion years ago.
It also requires them to believe their god lied when it provided a fossil record which appears exactly as it would do if life evolved from a common ancestor 3.5 billion years ago, including the very many detailed series showing gradual change over time.
It also requires them to believe their god lied when it arranged the distribution of related species of animals to look exactly as they would if the movement of the tectonic plates was just as it would be if the earth was 4 billion years old and life had been evolving on it for most of that time.
Of course, if you believe in an omnipotent god you have no difficulty at all in believing it COULD have arrange all that evidence, distributed throughout the universe, and especially on earth, to make it look that way just to mislead us, or to test our 'faith' in it.
The only problem is that this requires us to believe that their god is an almighty liar.
Given the choice between believing their favourite book or believing the evidence they believe their god created in the physical evidence, Creationists believe their god lied in the physical evidence. They are sure of this because it wrote a book it which it said it was telling the truth.
Creationists can be sure their god is a liar because it said it tells the truth in a book!
There's logic there Jim, but not as we know it.
It seems that Creationists would rather you believed their god is a deceitful liar than that their favourite book is not really a simple shortcut to pseudo-knowledge which saves a great deal of learning.
It really makes you wonder if Creationist believe what they try to persuade others to believe. I wonder what their god would think of them is it was real. This certainly doesn't seem to enter into their calculations...
Advertisement
Ten Reasons To Lose Faith: And Why You Are Better Off Without It
This book explains why faith is a fallacy and serves no useful purpose other than providing an excuse for pretending to know things that are unknown. It also explains how losing faith liberates former sufferers from fear, delusion and the control of others, freeing them to see the world in a different light, to recognise the injustices that religions cause and to accept people for who they are, not which group they happened to be born in. A society based on atheist, Humanist principles would be a less divided, more inclusive, more peaceful society and one more appreciative of the one opportunity that life gives us to enjoy and wonder at the world we live in.
Available in Hardcover, Paperback or ebook for Kindle
The following is based on a post on Compuserve Science & Maths Forum in about 1995 by the late Marijke Van Ganz. I paraphrase from memory and have certainly not done justice to Marijke whose succinct and poetic use of language enthralled those privileged to read her contributions to on-line debates.
Getting Milk.
Who says humans are the most intelligent species?
Down in the valley the Homo sapiens are busy capturing wild cattle, rounding them up into herds, taming them, erecting stout fences, building the milking parlours, making buckets and earthenware pots to collect and keep the milk....
Meanwhile, Felis catus rouses herself under the tree on the hill where she had been dozing in the warm sunshine, stretches, yawns, surveys her estate then wanders over to see how the work is progressing, says "Meow!" and gets milk.
Natural selection ensures the most utilitarian method works. Maybe we humans are fortunate our genes didn't form the same alliance with those of another species the way domestic cat genes did with ours.
Not sure where this came from but it's been around for years. I first saw it on a Compuserve forum in about 1995. If anyone recognises it please let me know so that I can give due credit.
FROM A DOG'S DIARY
Day number 180
8:00 am - OH BOY! DOG FOOD! MY FAVORITE!
9:30 am - OH BOY! A CAR RIDE! MY FAVORITE!
9:40 am - OH BOY! A WALK! MY FAVORITE!
10:30 am - OH BOY! A CAR RIDE! MY FAVORITE!
11:30 am - OH BOY! DOG FOOD! MY FAVORITE!
12:00 noon - OH BOY! THE KIDS! MY FAVORITE!
1:00 PM - OH BOY! THE YARD! MY FAVORITE!
4:00 PM - OH BOY! THE KIDS! MY FAVORITE!
5:00 PM - OH BOY! DOG FOOD! MY FAVORITE!
5:30 PM - OH BOY! MOM! MY FAVORITE!
Day number 181
8:00 am - OH BOY! DOG FOOD! MY FAVORITE!
9:30 am - OH BOY! A CAR RIDE! MY FAVORITE!
9:40 am - OH BOY! A WALK! MY FAVORITE!
10:30 am - OH BOY! A CAR RIDE! MY FAVORITE!
11:30 am - OH BOY! DOG FOOD! MY FAVORITE!
12:00 noon - OH BOY! THE KIDS! MY FAVORITE!
1:00 PM - OH BOY! THE YARD! MY FAVORITE !
4:00 PM - OH BOY! THE KIDS! MY FAVORITE!
5:00 PM - OH BOY! DOG FOOD! MY FAVORITE!
5:30 PM - OH BOY! MOM! MY FAVORITE!
Day number 182
8:00 am - OH BOY! DOG FOOD! MY FAVORITE!
9:30 am - OH BOY! A CAR RIDE! MY FAVORITE !
9:40 am - OH BOY! A WALK! MY FAVORITE!
10:30 am - OH BOY! A CAR RIDE! MY FAVORITE!
11:30 am - OH BOY! DOG FOOD! MY FAVORITE!
12:00 noon - OH BOY! THE KIDS! MY FAVORITE!
1:00 PM - OH BOY! THE YARD! MY FAVORITE!
1:30 PM - ooooooo. bath. bummer.
4:00 PM - OH BOY! THE KIDS! MY FAVORITE!
5:00 PM - OH BOY! DOG FOOD! MY FAVORITE!
5:30 PM - OH BOY! MOM! MY FAVORITE!
My captors continue to taunt me with bizarre little dangling objects. They dine lavishly on fresh meat, while I am forced to eat dry cereal. The only thing that keeps me going is the hope of escape and the mild satisfaction I get from ruining the occasional piece of furniture. Tomorrow I may eat another houseplant.
DAY 761
Today my attempt to kill my captors by weaving around their feet while they were walking almost succeeded, must try this at the top of the stairs. In an attempt to disgust and repulse these vile oppressors, I once again induced myself to vomit on their favorite chair ... must try this on their bed.
DAY 765
Decapitated a mouse and brought them the headless body, in attempt to make them aware of what I am capable of and to try to strike fear into their hearts. They only cooed and condescended about what a good little cat I was ... Hmmm. Not working according to plan.
DAY 768
I am finally aware of how sadistic they are. For no good reason I was chosen for the water torture. This time however it included a burning foamy chemical called "shampoo." What sick minds could invent such a liquid. My only consolation is the piece of thumb still stuck between my teeth.
DAY 771
There was some sort of gathering of their accomplices. I was placed in solitary throughout the event. However, I could hear the noise and smell the foul odor of the glass tubes they call "beer ..." More importantly I overheard that my confinement was due to MY power of "allergies." Must learn what this is and how to use it to my advantage.
DAY 774
I am convinced the other captives are flunkies and maybe snitches. The dog is routinely released and seems more than happy to return. He is obviously a half-wit. The bird on the other hand has got to be an informant, and speaks with them regularly. I am certain he reports my every move. Due to his current placement in the metal room his safety is assured. But I can wait, it is only a matter of time ...
Browsing casually through the KJV Bible today, I came across these curious passages.
