Showing posts with label Evidence. Show all posts
Showing posts with label Evidence. Show all posts

Monday, 25 May 2026

How Creationists Lie To Us - Ken Ham Shows Us His Cult Is For Fools Who Believe Lies


Tiny fossils found in 1.7 billion-year-old mud yield clues to the evolution of complex life.

The creationist Ken Ham’s website, Answers in Genesis (AiG), is notorious for the way it exploits the ignorance of its target readership and their eagerness for spurious “scientific” validation of evidence-free superstition. For example, AiG recently posted on X, formerly Twitter, asserting that the fossil record is “the graveyard of the global flood”:

What AiG does not say, of course, is that fossils are not found in a chaotic jumble, as would be expected from a single global catastrophe. They occur in a consistent geological sequence, with older rocks containing older fossil assemblages and younger rocks containing later ones. The succession is not random; it records changing environments, extinctions, radiations and evolutionary transitions over immense spans of time. The rocks themselves contain independent evidence of their age and origin — including stratigraphic relationships, geochemical signatures, volcanic ash layers where present, and other dating markers — and many sedimentary sequences accumulated gradually over thousands, millions, or even hundreds of millions of years.

Nor do fossil-bearing rocks show the global mixing that a planet-wide genocidal flood should have produced. Instead, they preserve organisms that lived in particular environments at particular times. Marine organisms occur in marine sediments; freshwater organisms in freshwater deposits; terrestrial organisms in terrestrial deposits. Local and regional faunas remain local and regional.

We do not find Australian marsupials randomly mixed through Cambrian marine deposits, nor African mammals churned together with Jurassic dinosaurs and Ordovician trilobites. If a flood had covered even the highest mountains, tearing up ecosystems across the planet and carrying bodies wherever the currents took them, that is exactly the kind of disorder we should expect. It is not what the fossil record shows.

So, far from proving there was a global genocidal flood just a few thousand years ago, fossils in sedimentary rocks demonstrate exactly the opposite. They record a long, ordered, localised and historically structured history of life on Earth. That history is not only incompatible with the childish flood myth promoted by AiG; it is one of the strongest lines of evidence for evolution over deep time. And that is probably why Ken Ham’s creationist organisation needs its followers to believe otherwise. The tactic is perfectly plain and deliberately dishonest: if the facts contradict your claims, misrepresent the facts.

Thursday, 15 January 2026

How We Know The Bible is Wrong - Cosmology


NGC 2566, a spiral galaxy located in the constellation Puppis

These two galaxies are named NGC 4490 and NGC 4485, and they’re located about 24 million light-years away in the constellation Canes Venatici (The Hunting Dogs). Aside from the Milky Way’s own dwarf companions (the Large and Small Magellanic Clouds), this is the closest known interacting dwarf-dwarf system where astronomers have directly observed both a gas bridge and resolved stellar populations. Together NGC 4490 and NGC 4485 form the system Arp 269, which is featured in the Atlas of Peculiar Galaxies. At such a close distance (and with Webb’s impressive ability to peer through dusty cosmic clouds) these galaxies allow astronomers to witness up close the kinds of galaxy interactions that were common billions of years ago.
Source: potm2511a

Just a gentle reminder, if any were needed, that we can tell the Bible is wrong by comparing its descriptions with what we can observe. To take a silly-simple example that even a creationists should be able to understand: supposing I told you that the Bible had 7 chapters in three sections, the Old, Middle And New Testaments, and was just 50 pages long, you could simply look in the Bible and see that I was wrong. It would be no use me trying to claim that I was right really because my statement was an allegory or a metaphor, because you could see that it was neither; it was simply wrong, unequivocally and irrefutably so.

Well, it's the same with the description of the Universe in the Bible. We can look at the Universe now, using technology the Bronze Age authors of the Bible could never dream of, and see that it is nothing like the description in the Bible.

So, just as my whimsical description of the Bible was not even close, so we can see that the Bronze age authors of the Bible were not even close. The difference of course is that while my mistakes were deliberate, theirs were the result of ignorance.

So, let's see again how the Bible describes a small, flat universe consisting of a single planet with a sun and moon hanging over it, and the whole covered by a dome to keep the water out.
And God said, Let there be a firmament in the midst of the waters, and let it divide the waters from the waters. And God made the firmament, and divided the waters which were under the firmament from the waters which were above the firmament: and it was so. And God called the firmament Heaven. And the evening and the morning were the second day. And God said, Let the waters under the heaven be gathered together unto one place, and let the dry land appear: and it was so. And God called the dry land Earth; and the gathering together of the waters called he Seas: and God saw that it was good. (Genesis 1.6-10)

And God made two great lights; the greater light to rule the day, and the lesser light to rule the night: he made the stars also. And God set them in the firmament of the heaven to give light upon the earth, And to rule over the day and over the night, and to divide the light from the darkness: and God saw that it was good.(Genesis 1.16-18)
How the Bible's authors saw the Universe.

And now let's look at what some tiny fragments of the Universe are really like, as shown by the James Webb Space Telescope and published by the European Space Agency (ESA):

Thursday, 25 July 2024

Unintelligent Design News - When Genes Misbehave - Another Design Blunder?


'Preparing the popular film of a Taube soaring above Rheims cathedral'

W. Heath-Robinson (1915)
‘Gene misbehaviour’ widespread in healthy population

Creationism's putative designer is like William Heath Robinson but without the competence.

Like creationism's putative designer, William Heath Robinson's 'irreducibly complex' designs are ludicrously over-complicated solutions to simple problems, but at least Heath-Robinson's machines look as though they would work if ever anyone constructed one.

Designed by creationism's supposed omniscient, omnipotent designer the bits of knotted string used to connect things together, and originally designed for a different purpose altogether, would have knots that came undone, or they would be made of elastic, or the chair used to stand something on to make it tall enough would have a broken leg.

The problem starts with the clunky workaround for the problem caused by using the same method for replicating cells in a multicellular organism that is used in single-celled organisms where the entire genome has to be duplicated in each daughter cell. But in a multicellular organism, where there is cell specialisation to gain any benefit from multicellularity, each specialist cell only needs a few genes, so the rest have to be switched off. Creationism's divine incompetence came up with the usual overly complex solution to this problem of its own making in the form of the epigenetic system, adding an unnecessary layer of complexity when the simple solution would have been to give each specialist cell just the genes it needs and no more.

And this become even more complicated when, during the life of a multicellular organism, specialist cells need to change slightly according to the needs of the organism as a whole, so a system of signals had been devised to tell the cells when to switch on some genes and switch off others. Another layer of complexity, and this is where things start to go wrong - the equivalent of Heath-Robinson's knotted string coming undone or stretching, or the chair supporting the entire structure starting to buckle.

Scientists at the Wellcome Sanger Institute's Wellcome Genome Campus, Hinxton, Cambridgeshire, UK, Cambridge University and AstraZeneca have discovered that genes are sometimes active when they should be switched off, even in healthy people.

Saturday, 23 March 2024

Creationism in Crisis - Now It's a Giant Amazon Dolphin from 16 Million Years Before 'Creation Week'!


Type specimen (holotype) of Pebanista yacuruna, including a photo of the specimen and a surface 3D model in dorsal view.

Image: Aldo Benites-Palomino.
Ancient Giant Dolphin Discovered in the Amazon | | UZH

The third in a clutch of very recent papers casually refuting the childish beliefs of the creation cult.

This one concerns a giant freshwater dolphin that inhabited the Amazon 16 million years before creationists think there was a Universe, let alone an Earth with life on it.

Tell me about the Peruvian Amazon 16 million years ago. Around 16 million years ago, during the Middle Miocene epoch, the Peruvian Amazon region would have been significantly different from its present-day appearance. This period falls within the broader geological timeframe known as the Neogene Period, characterized by significant changes in climate and biodiversity.

During this time, the Amazon basin was undergoing a transformation from a relatively dry environment to a more humid and tropical one. The climate was warmer and wetter compared to today, with vast stretches of lush tropical rainforest covering much of the region.

The landscape would have been dominated by dense forests, rich in diverse flora and fauna. Ancient ancestors of many of today's Amazonian species would have been present, including various types of plants, mammals, birds, reptiles, and insects. Megafauna such as giant ground sloths, glyptodonts, and various types of large herbivores and predators may have roamed the area.

The river systems of the Amazon basin would have been different as well, as the Andes Mountains continued to uplift and shape the landscape. However, the basic hydrological structure of the Amazon River and its tributaries would have already been established, providing the necessary water sources for the flourishing ecosystems.

Overall, the Peruvian Amazon 16 million years ago would have been a vibrant and biodiverse ecosystem, albeit with species compositions and environmental conditions differing from those of today due to ongoing geological and climatic changes over millions of years.

Wednesday, 6 March 2024

Creationism in Crisis - Earliest Toothless Bird From 120 Million Years Ago


Imparavis attenboroughi, a 'strange bird' named after Sir David Attenborough, British broadcaster and naturalist
Fossil named “Attenborough’s strange bird” was the first of its kind without teeth - Field Museum

It seems every week is a bad week for creationists, yet the wackadoodle cult staggers on, albeit with dwindling numbers, managing as always to ignore anything that shows their childish superstition to be wrong.

On top of the recently-reported predatory marine lizard, from 66 million years ago, we now have the earliest bird without the teeth of its enantiornithine ancestors. The enantiornithines were a diverse class of avian dinosaurs that went extinct 66 million years ago following the meteor impact that killed most of the dinosaurs. Only the ornithuromorphs survived, for reasons not completely understood, and they gave rise to all modern birds.

Tuesday, 20 February 2024

Creationism in Crisis - How An Ancient Retrovirus Evolved To Create The Vertebrate Brain


Ancient retroviruses played a key role in the evolution of vertebrate brains | ScienceDaily
Schematic diagram of a neuron show the myelin sheath as the electrical insulator of the axon.

Extinct Late Devonian placoderm Bothriolepis canadensis. Myelin first appeared in these primitive early fish

Credit: Nobumichi Tamura / Stocktrek Images / Getty.
Creationists generally hate endogenous retrovirus (ERV's) because:
  1. They are one of the strongest pieces of evidence of common descent appearing in the same locations in the genome of all organisms in a clade, forming nested hierarchies exactly as the Theory of Evolution predicts. The probability of the same viral DNA appearing in the same locus in all species in a clade by chance is, of course, so small it can be dismissed as an explanation.
  2. They form a large part of the 'junk' DNA carried by all organisms, which, although a small proportion of it is transcribed into RNA, the RNA doesn't get translated into proteins and most of it doesn't serve any purpose. Some, but by no means all of it may have some regulatory functions.
  3. Occasionally, an ancient ERV may have become exapted for some useful purpose unrelated to the original virus, so showing how new genetic information can enter a genome, flatly contradicting creationist's claims that no new information can arise within a genome because the second law of thermodynamics [sic] and Shannon Information Theory somehow forbids it.
  4. An ERV serving a useful purpose also contradicts creationist claims that, while their favourite creator god is responsible for all the good stuff, another creator, called 'Sin', is responsible for the harmful stuff like parasites and viruses. Yet in those exapted ERVs we have viruses providing something that is beneficial and therefore, according to creationist dogma, must have been provided by their god!
  5. Lastly, the examples of where ancient ERVs have mutated and provided some additional ability or function, such as enabling the formation of the myeline sheath in vertebrates, can't be regarded as detrimental mutations, yet creationist dogma, courtesy of the hapless Micheal J. Behe, is that all mutations are 'devolutionary'[sic].

Thursday, 8 February 2024

Creationism in Crisis - A New Endogenous Retrovirus Caught In The Act Of Invading a Genome


A rare recent case of retrovirus integration: An infectious gibbon ape leukemia virus is colonising a rodent’s genome in New Guinea - Leibniz Institute for Zoo and Wildlife Research

Researchers have discovered that a retrovirus is currently in the process of invading the genome of a rodent in New Guinea. This will add to the extensive list of known endogenous retroviruses. The virus, which appear to be harmless to the rodent - a mosaic tailed rat of the Melomys genus - is an infectious virus that causes leukemia in gibbons.

A retrovirus is an RNA virus that 'hides' in its host's DNA by inserting the DNA template for its RNA, using the enzyme reverse transcriptase that is coded for in its RNA. Once inserted it is replicated by every daughter cell. If it is inserted into the DNA of a germline cell, it can be passed on to the next generation.

Endogenous retroviruses (ERVs) are common in the genomes of all multicellular organisms and even some single-celled organisms, and as such constitute a large proportion of the non-coding or 'junk' DNA. A few may have been exapted for other purposes, but most are simply strands of viral DNA with a few mutations that broke them and rendered them harmless way back in our evolutionary history.

ERV's provide some of the most compelling evidence for common descent, especially since they appear at the same locus in the genomes of almost all members of a clade such as the vertebrates, including fish ancestors or the terrestrial vertebrates. The probability of the same ERV with the same mutations in in the same genetic locus to make it look like they form nested hierarchies, is vanishingly small, yet they do it over and over again.

The fact that they are present in all members of the same major clade tells us they must have been present in the last common ancestor of that clade, so they are a double embarrassment for creationists. They are both evidence of descent with modification and that there was no intelligence in the design of our genomes, because an intelligent designer would have no reason to include broken viral DNA which adds nothing by way of functionality yet must be replicated in every cell.

Monday, 5 February 2024

Creationism in Crisis - Scientists Are Understanding More About How Plants Evolve and Diversify - No God-Magic Required


Ecological Diversification in an Adaptive Radiation of Plants: The Role of De Novo Mutation and Introgression | Molecular Biology and Evolution | Oxford Academic
An effective way to refute the counter-factual claims of a wackaddodle cult like creationism is simply to reveal the facts and show how different they are to the cult beliefs. Sadly, this approach won't convince many creationists of course, especially those too arrogant to think their beliefs can be contradicted with mere facts, because part of being a creationist is to hold the self-idolatrous belief that your beliefs are inerrant, so trump anything science can produce, but one can but try.

In fact, researchers in biomedical sciences don't even try, they have more important things to do than try to convince fools who reject evidence before they see it and who are proud of the fact that nothing can make them change their minds. Scientists just discover the facts and add to the mountain of evidence that creationists have been conditioned to ignore or dismiss as lies or otherwise relegate to the realm of the unimportant.

For example, this week’s edition of Oxford University Press' journal Molecular Biology & Evolution has 10 different open access papers dealing with the minutia of evolution and not one of them shows any sign that the scientists are abandoning the Theory of Evolution as not fit for purpose and adopting instead, creationism's childish superstition complete with magic and unproven supernatural entities, as creationist cult leaders regularly tell their dupes.

None of these papers mention creationism or point out how the research findings refute it, of course, because they are written for people who understand the science, so don't need that to be pointed out to them. These are:

Monday, 29 January 2024

Creationism in Crisis - How An Iconic Australian Plant Originated in Africa - 132 Million Years Before 'Creation Week'


Banksia spinosa inflorescence

Banksias are iconic Australian plants, but their ancestors actually came from North Africa

No real scientists these days sets out to refute creationism as such, but most do anyway, because creationism is so counter-factual that almost any scientific facts, especially in the fields of biology, cosmology, archaeology, geology and palaeontology refute it. It takes a resolute and determined ignoramus to not be aware of that. The problem creationists have is that they get all their beliefs from an ancient text that is demonstrably wrong, even when explained away as allegorical or metaphorical. It is neither. It is quite simply wrong on every level.

So, creationists are left desperately trying to defend the childishly absurd claim that the entire Universe, including Earth and all living things on it, were all created out of nothing in a few days, about 10,000 years ago, by a magic man also made of nothing who designed himself before he existed then self-assembled according to that plan, with all the complexity and information needed to create and micromanage an entire Universe.

This, despite the fact that there are fossil remains of plants and animals from hundred, even thousands of millions of years before then and despite the fact that all the evidence points to a long, slow, evolutionary process of divergence from a common ancestor that lived well over a billion years ago, which was itself the result of a symbiotic associations of much earlier organisms.

One such paper, which casually and incidentally refutes creationism, recently published in Perspectives in Plant Ecology, Evolution and Systematics by three Australian botanists and plant ecologists and a South African Professor of botany, traces the origin of the family of iconic Australian plants, the Banksias, to North West Africa, 132 million years ago.

The story of this migration meshes in with the sciences of plate tectonics and oceanography allowing the plants to migrate across then contiguous land masses from what is now North West Africa to what is now Australia via South America and Antarctica, as land-masses split and diverged and sea-levels rose and fell to reveal land bridges where there is now ocean.

How they discovered this is the subject of an article in The Conversation by the four scientists. Their article is reprinted here under a Creative Commons licence, reformatted for stylistic consistency:

Saturday, 20 January 2024

Creationism in Crisis - Biologist Watch Dawinian Evolution Happen - No Magic Was Involved


How does one species become many? | Newsroom - McGill University

Classical (Darwinian) evolution theory explains diversification of one species into several by hypothesising that an advantageous trait in any given environment will convey a fitness advantage in that environment, so carriers of that trait will have more descendants than non-carriers. As the environment varies so the advantageous traits with vary.

Although the logic of that is indisputable, formal proof of it in terms of observing it leading to diversification is hard to come by for several reasons, not the least of which is that speciation can only really be identified retrospectively when a large enough population exists to be able to say this is a new species, and not just a variant. There was no way to predict that a given individual or small population would actually become a new species so no reason to watch what happened. I explained this some time ago in a blog post about monkey diversification, subsequently confirmed by observation.

So, to the consternation of creationists, an international group of biologists led by McGill University have set about providing the evidence to validate the hypothesis, and, to make matters worse for creationists, they did it using the Galápagos finch, also known as Darwin's finch, that gave Charles Darwin the idea of evolution by natural selection as the explanation for biodiversity. So, this work not only validates basic Darwinian theory but also validates Darwin's choice of an example of it.

The biologists’ findings, based on 17 years of observations, are published open access in Evolution and are explained in a McGill University press release:

Creationism in Crisis - An Early Mammal Was Preying On Dinosaurs 125 Million Years Before Earth Existed (According To Creationists)


Fossil: Mammal attacks dinosaur - Canadian Museum of Nature
The fossil sowing the entangled skeletons of the dinosaur (Psittacosaurus) and the mammal (Repenomamus). Scale bar equals 10 cm.
125 years before Earth was magicked out of nothing, according to creationists, there were early mammals preying on dinosaurs in Canada. The problem creationist have is that they get all their information from tales made up by primitive people who knew nothing of Canada, dinosaurs or early mammals and though Earth was created by magic just a few years earlier.

This is how we can tell that their favourite source book is worthless as an account of real science, biology, geography and history. It is quite simply demonstrably and unarguably so wrong about just about everything, as we now know, that it's laughable that grown adults believe any of it.

Q: How do we know that early mammals were preying on dinosaurs 125 million years ago?

A: Because we have the evidence.

It comes in the form of a fossil of an early mammal attacking a dinosaur, dated to 125 million years old, as described in a paper published in the journal Scientific Reports. The fossil shows a (smaller) mammal in the process of attacking or maybe even eating alive, a (larger) dinosaur. The pair were suddenly engulfed in a volcanic debris flow.

As a news release from the Canadian Museum of Nature explains:

Monday, 15 January 2024

Creationism in Crisis - Sturgeons in Alberta 72 million Years Before 'Creation Week'


Credit: University of Alberta
72-million-year-old sturgeon discovered in Edmonton is a fossil first | Folio

Once upon a time, just a few thousand years ago, a magic man made of nothing appeared from nowhere and said some magic words that magicked a whole universe out of nothing. Right in the middle of that universe he made a small flat planet and put a dome over it to keep the water above the sky out, then he magicked some people, some plants and some animals and this took him nearly a whole week. Even though he did it all with a few magic words, this made him so tired he needed a day off.

After a while he decided he didn't like what he had made because he had given the people free will and they were using it, so he drowned them all apart from a few, then started again without changing his original design, hoping things would turn out differently this time.

What he hadn't realised was that he had only gone and created this imaginary world in a small part of a really big Universe that had been there for billions of years and already had a planet with lots of animals on it, so, although he had started off 'going down' to chat to the humans he had magicked, he promptly disappeared, never to be seen again, almost as though he had gone back to being nothing. Meanwhile, the real planet in the real universe carried on the way it had always done, as though no magician had ever done anything magical.

One of those animals on the real planet was a fish called a sturgeon which lived in what is now Alberta, Canada, 75 million years before 'Creation Week', which is why scientist were able to find a fossil of it in rocks known to be between 84 and 72 million years old. It's little clues like this, and the complete lack of any evidence of magic, that tells us the story of that fantasy creation was wrong and made up by ignorant people who didn't know any better.

The discovery of the fossil sturgeon was announced in a paper in the Journal of Vertebrate Paleontology last August and announced to the press in a news release just a couple of days ago:

Saturday, 14 October 2023

Creationism in Crisis - This Fossil Marsupial is Thirteen Thousand Times Older Than The Universe, According to Creationists


Anachlysictis gracilis stalking its prey in the La Venta area of Colombia, 13 million years ago. (artists impression)

Credit: Juan Giraldo
Prehistoric predator | Smithsonian Tropical Research Institute

Scientists have unearthed the fossilised remains of a predatory sabre-toothed marsupial that lived in what is now Columbia in northwestern South America, 13 million years ago, during the Cenozoic, the period which followed the extinction of the dinosaurs, which cleared the way for a rapid diversification of mammals.

The fossil is of Anachlysictis gracilis, one of the family of predatory marsupial known as the Thylacosmilidae.

Tuesday, 2 April 2019

Malevolent Design News - A New Way To Make Us Sick

Asian longhorn tick, Haemaphysalis longicornis
Photo credit: Center for Disease Control and Prevention
New Yorkers Brace for Self-cloning Asian Longhorned Tick | Columbia News.

Creationism's Malevolent Designer has been busy recently. Not only have we recently learned how it has armed a bacterium with a virus to use to trick our immune systems so it can prevent wounds from healing, we have just discovered how it has designed a new way to deliver parasitic pathogens directly into our bloodstream.

This delivery system is the Asian longhorn tick, Haemaphysalis longicornis, an invasive species that is rapidly becoming common in Staten Island, New York, USA, and will almost certainly spread from there. Ticks are arachnids which live as blood-sucking parasites, mostly on vertebrates. Like other blood-sucking parasites they can transfer blood-borne infections between its hosts.

Sunday, 13 January 2013

If Religions Were True They Wouldn't Need Dogma.

Because I said so!
Why do religions require dogmas (or should that be dogmata)? Why can't they do what science does and use evidence?

Dogma is the official system of belief or doctrine held by a religion, or a particular group or organization. It serves as part of the primary basis of an ideology or belief system, and it cannot be changed or discarded without affecting the very system's paradigm, or the ideology itself. They can refer to acceptable opinions of philosophers or philosophical schools, public decrees, or issued decisions of political authorities.

In religion:
Dogmata are found in religions such as Christianity, Judaism, and Islam, where they are considered core principles that must be upheld by all believers of that religion. As a fundamental element of religion, the term "dogma" is assigned to those theological tenets which are considered to be well demonstrated, such that their proposed disputation or revision effectively means that a person no longer accepts the given religion as his or her own, or has entered into a period of personal doubt. Dogma is distinguished from theological opinion regarding those things considered less well-known. Dogmata may be clarified and elaborated but not contradicted in novel teachings (e.g., Galatians 1:6-9). Rejection of dogma may lead to expulsion from a religious group.

Monday, 2 April 2012

If It Wasn't For Evolution We Wouldn't Have Science

No, you read the title correctly. It isn't science that gave us evolution; it is evolution which is giving us science. It was science which discovered evolution of course, because science is all about discovering things that have always been there.

For evolution you need three basic things:
  1. Competition between different versions
  2. Selection based on a test of fitness.
  3. Replication.

And the 'winner' is the version which produces the most copies and eventually vanquishes the other version.

Of course, this is normally thought of in terms of genes and biology, but genes are not the only things which meet these three requirements. Another is scientific hypotheses.

Science can (should?) be seen as a body which consists of hypotheses which are either still in competition or,  for all practical purposes have played out the competition and determined the winner.  As the hypotheses compete and emerge as winners, they give rise to new hypotheses and so the whole body of science progresses and develops and tends toward a closer approximation to the truth.
I'll take a simple idea to illustrate this.

The competing hypotheses. There was once a time when most people in the West believed the earth was flat, despite the fact that Eratosthenes had shown it not to be in about 240 BCE. The two ideas - flat earth and spherical earth  - both existed in the ideas pool. The flat earth idea predominated but never entirely exterminated the spherical earth idea. The flat earth idea had been useful to an extent but it meant that people were afraid of falling over the edge, so progress in exploration was limited.  These were versions of the 'shape of earth' idea.

The test for fitness. Gradually, as more and more knowledge was accumulated more and more people came to hold to the spherical idea. Even Saint Augustine of Hippo (354-430 CE) seems to have accepted that the earth was spherical. He went so far as to argue that there could not be people living on the far side of earth because, since they must have been descended from Adam they would have had to build ocean-going ships to take them there.

He said, "It is too absurd to say, that some men might have taken ship and traversed the whole wide ocean, and crossed from this side of the world to the other, and that thus even the inhabitants of that distant region are descended from that one first man", but I won't dwell too long on Saint Augustine's inadvertent ridiculing of the idea that everyone is descended from the biblical Adam.

The point here is that in the competition for ideas, the spherical earth idea was winning because, with more information, more people became convinced it was the best explanation of the evidence. For a scientific hypothesis, this is the only real test for fitness.

So, by 1492 Christopher Columbus not only knew the earth was round but was prepared to prove that sailing West was the quickest way to China, thinking earth was much smaller than it turned out to be.  In so doing he not only failed to reach China but thought he had missed and was in India; and so misnamed the aboriginal inhabitants of the Caribbean and the New World which he had accidentally discovered in the process.

Replication. That just about convinced all but a few remaining die-hards that earth is spherical, but a few lingered on until we were able, with science, to go out into space and look at earth from a distance and see that it is spherical. Now belief in a flat earth is more likely to be a symptom of delusion and insanity than of a rational thought process. The idea of a flat earth is now replicated in the minds of just about everyone who ever took a basic geography lesson or saw a photograph of earth from space. No one in their right minds would think of telling their children anything but that earth is spherical. (Actually an oblate spheroid, just to deter hair-splitters and creationists looking for something to distract attention with).

We now have what amounts to a scientific 'Law'. The Spherical Earth Theory is not seriously disputed by anyone with any knowledge of the facts. It is a comprehensive, falsifiable theory to explain the observed facts, supported by evidence, able to make and test predictions, and it has not been falsified.

So the body of science was changed by a Darwinian evolutionary process in which one idea won in a test for fitness and came to dominate the ideas pool to the almost total exclusion of its rival. The body of science has so progressed, making other hypotheses like plate tectonics, weather system generation and ocean currents possible.

Exactly the same principle can be applied to any scientific ideas and competing alternative hypotheses, whether it's about the best fuel for a rocket motor to get the the moon, the best rubber for a car tyre, the best Internet Transfer Protocol or the best explanation for the origin of living things.

Without this Darwinian evolutionary process, 'science' would be a primordial soup of conflicting and contradictory notions none of which could be said to be any better than the other, and there would be no basis for using new knowledge that competitive selection of ideas produces, to develop new hypotheses, and so no progress would be possible. Indeed, there would be no basis for even describing a 'body of science'. Science and scientists could not exist.

So, if you imagine you don't believe in evolution you have to explain why science knows more now that it did before; why it can give us modern technology like radios, television and telephones where previously it could not; why we have better medicine now than we used to have and why I can post this blog on the Internet for you to read on your computer or mobile when, just a few years ago, this would have been literally unthinkable.

Where did that idea come from?

It evolved by Darwinian evolution out of earlier, less complex and less well defined ideas built themselves on earlier hypotheses.  The fossils of this evolutionary process can be found in old science books and journals, in museums of technology and maybe in the minds of old, retired scientists.  Deformed and mutant forms of these ideas can frequently be found in the minds of creationists, priests and religious apologists and their followers.

If you dispute this, you have to explain why the process I outlined is not a Darwinian evolutionary process. Good luck with that.





submit to reddit





Thursday, 29 December 2011

Jesus - History or Hoax?

This blog is derived from a Tweetlonger tweet by @dawkinsassange in reply to @tndan who cited Christianity: HOAX OR HISTORY by Josh McDowell as 'proof' of the historicity of Jesus.

I reproduce it here as a refutation of that book and of the many fallacious and inaccurate claims contained in it.

My thanks to @dawkinsassange for permission to reproduce it.

Pgs. 38-39 Appeal to Authority fallacy. Answered in this link.

Pgs. 40-41 No contemporary evidence of Apostles (earliest 150 AD)

Pgs. 41-44 Guilt by association fallacy & faulty analogy. The Watergate conspirators were not being promised eternal rewards in heaven. If these martyrs existed, I have no doubt they BELIEVED, which is irrelevant to actual events.

Pgs. 45-46 Appeal to Authority fallacy

Pg. 47 "Strong evidence that the NT written at an early date" not supported in text. Only assertions.

Pg. 48 "Oral tradition not long enough.." Proof? Evidence?

Pgs. 49-51 So there's no originals. Therefore unknown numbers of errors.

Pgs. 52-54 Much of the NT was admitted to be hearsay. The writer of Mark's confusion with Palestinian geography is circumstantial evidence that Mark wasn't there.

Pgs. 54-55 The contradictions between NT writers indicate lies.

Pgs. 55-58 An alternative explanation that doesn't include miracles is that it is all legendary.

Pgs. 58-59 Writers a hundred years after the event don't add a lot to historicity. In fact, there were many contemporary writers who never attested to Jesus.

Pgs. 59-60 Luke doesn't agree with Josephus.

Pg. 60 "One test of a writer is consistency" Agreed. Luke fails.

Pgs. 61-62 The same standard must be set to the Bible as other secular literature. No. Extraordinary claims require extraordinary proof. Otherwise it must be treated the same as other ancient records of legends such as Hercules.

Pgs. 62-63 Criterion of embarrassment argument. Limited in application and not proof that the event happened as described. May be used to fit writer's theology.

Pgs. 65-69 I felt the same joy when released from indoctrination.

Pgs. 73-79 Preaching and selling stuff.

Pgs. 81-83 Disagree. Bible is consistent only in it's inconsistency. It shows every indication of being written by ancient superstitious people.

Podcasts by Peter Coote (@cootey59) also dealing with this may be heard here.

Hoax or History? I vote Hoax

[Yet to be added: Josh McDowell's reply.]

[Further update: despite repeated invitations spread over several weeks, Josh McDowell failed to reply or even acknowledge the invitations.]





submit to reddit




Income from ads will be donated to charities such as moderate centre-left groups, humanist, humanitarian and wildlife protection and welfare organisations.

Tuesday, 20 December 2011

Evolution - The Meaning of Information


Go to any creationist website and you will find any number of 'creation scientist' explaining to their credulous and gullible readership and potential customers that information theory proves that no new information can arise by a random process, or some such half-baked notion, so the Theory of Evolution must be wrong (so a magic man magicked everything and it must have been the locally popular one, obviously, as eny fule kno).

Where do they get these ideas from?

Mutations in DNA are relatively common because the copying process is not perfect, despite the mechanisms which have evolved to correct them.

I'll not go into the so-called genetic code here because, with a few clicks on Google, or by opening any of very many books on the subject, this can be easily found by those who wish to know more. Those who don't won't have bothered reading this far.

If anyone can tell me why a mutation which changes the genetic code for a small portion of a given enzyme from, let's say, UUAUAUCAUGUAGAUAACCCCUGA to UUAUCUCAUGUAGAUAACCCCUGA in the short sequence of mRNA, is prohibited by the second law of thermodynamics, I'd be very grateful...

Thursday, 7 July 2011

Proving Your God Should Be Simple

Christians, Muslims, Sikhs, in fact all theists have a very simple task if they want to convince us their god did something. Having decided on your evidence, there are only two steps:
  1. Show beyond a reasonable doubt that a natural explanation for it is impossible. If it’s not, there is no reason to invoke a supernatural one.
  2. Having so shown the only explanation is a supernatural one, show beyond a reasonable doubt that the only supernatural explanation is whichever god you are trying to show did it.
And that’s it. Easy-peasy.

So simple, it’s the work of a few minutes, especially since you must have gone through this process yourself to arrive at your belief... didn’t you?

In fact, it’s so simple, I’m puzzled that no one has ever done it.

[Later note: It seems many Creationists are struggling with the concept of evidence and so imagine quotes from a book of dubious provenance constitutes evidence. The following links provide useful information on this subject;

http://anotheratheist.tumblr.com/post/4050923890
http://anotheratheist.tumblr.com/post/5524880161

(Thanks to @kaimatai on Twitter for providing these helpful link)]





submit to reddit





Thursday, 21 April 2011

Do You Want to Convert an Atheist?


If you want to convert an Atheist your task should be simple. Atheists believe in evidence; our opinions are based on it and when the evidence changes, or we discover new evidence, we change our opinions. We have no sacred dogmas which can't be questioned; no tenets of 'faith' to which we must subscribe.

This should make us very easy to convert with the following three-step process:

  1. Produce the evidence that you found convincing.
  2. Explain why it is evidence only for your god and not any other. Since people have believed in over 3000 different gods in recorded human history, obviously you will need to show why your evidence couldn't be evidence for any of those.
  3. Explain how a god is the only possible explanation for your evidence and why it can't possibly be explained as the result of a natural process.

Now, since, presumably, you were convinced of your god's existence by just such evidence and just such a process, it shouldn't be too difficult to tell us Atheists where it's to be found and how it meets the above criteria.

In your own time....

Web Analytics