Thursday, 26 January 2012

An Evolving Sense Of Self

It's usually taken as given that a measure of high intelligence, in comparative terms between species, is that only the most intelligent species have a sense of self, in other words, it takes a high level of intellect to have self awareness.

A rather nebulous definition of 'self-awareness' is awareness of your own individuality which is about as useful as defining 'impressionist art' as 'art done by impressionists'.

A standard test of self-awareness used by animal psychologists is the mirror test. This test assumes that the more intelligent an animal is the more likely it will be to identify itself in a mirror. Apparently, all of the African apes, the orang utan and three species of gibbon have all passed the mirror test, and so have bottlenose dolphins, killer whales, elephants and European magpies (a bird of the crow family). All of these are known from other tests to be highly intelligent.

But I have long been suspicious that these test have an inbuilt species bias. They test not for intelligence or self-awareness but how similar the subjects are to humans in respect of the thing being tested.

To understand self-awareness you need to understand how our brains model the world around us and map it into a concept which can be projected into the future. We see cars moving in the street and project them forward in our conceptual model to calculate where they will be in a few seconds time and whether we can safely pull out in front of them, start to cross the road, or need to hurry over. We see other people and take verbal and nonverbal clues from them which we then place in our conceptual model to gauge how they might react to us according to what we do or say next.

And, to complete this model, we must include ourselves as an object in it. It is the awareness of how and where we fit in this model which we call self-awareness. It is our ability to include ourselves and to incorporate our own actions and reactions in our model world which makes us self-aware, and the construction and manipulation of this model is what we call 'consciousness'.

I remember standing outside the place where I worked in Oxford, on the edge of a local nature reserve run by the Berkshire, Buckinghamshire and Oxfordshire Wildlife Trust, which I am proud to support, and watching a grey squirrel travel though a small stand of beech trees. It was obvious the squirrel knew where it wanted to get too and had plotted a route which included frequent jumps across gaps, detours up one branch and down another and occasional pauses as it prepared itself for a particularly long jump.

Clearly, this squirrel had a conceptual model of its environment and had plotted a course through it. It was also clear that it had projected itself into that model and placed itself at each stage through that route. More importantly though, it had originally projected itself forward in its model world to where it wanted to be. I have yet to understand how it could have done that without self-awareness, yet our grey squirrel would probably never pass the mirror test and would be regarded as not especially intelligent.

Not every animal needs to navigate a route through the branches of a stand of trees of course, but many animals, especially predators, need to plan, even to chase down their prey. Simply to walk across the ground they need to 'know' where they want to get to. In Corfu I have also watched a snake, which I've never been able to identify as I didn't have a camera with me, hunting along the banks of a small stream, clearly looking for frogs and voles, and very clearly acting with purpose as it swam back and forth, working first one bank then the other and gradually working up the stream. I really don't see how it could have done this without a conscious sense of purpose and without placing itself in a conceptual model of its world, if only to swim across the stream.

During my life-time our idea of intelligence in other animal, especially mammals and birds, has changed. I remember when we took it as read that humans were the only thinking animals - our scientific name Homo sapiens means 'man who thinks' as though nothing else does. This was taken as a sign that we were a special 'creation'; somehow different in a material way to other animals which was, naturally, 'evidence' that we were somewhere between the angels and the rest of 'creation' with no doubt at all that the world was created especially for us.

We were, of course mistaken, as you would expect of an idea based on nothing more substantial than superstitions, which are themselves merely the projection of our anthropocentric arrogance onto our conceptual model of the universe, and of the assumption that the 'self' we include in our model is another entity which lives in our body and watches the world for us through the windows we call eyes; that reification we call a 'soul' which earlier superstitions had mistaken for consciousness.

Stories began to emerge from detailed studies of wild chimpanzees that they could make tools and practiced subterfuge - which needs self-awareness AND empathy with other chimps.  It was then recognised that all the great apes had a high level of intelligence and were self-aware.  Then marine biologists discovered that dolphins, including killer whales, were also highly intelligent. Some even claimed they may be MORE intelligent that humans. Certainly they seem to have a complex language which has so far defied human understanding.

Laboratory tests showed that rats can quickly learn their way through a maze, that some birds can solve puzzles and even fashion tools.

When milk started to be delivered to our doorsteps in foil-covered bottles, several species of bird, including blue and great tits, blackbirds, magpies and jackdaws all learned to open them to get the cream. This behaviour was mapped and was found to radiate out from centres where it started, showing that learning by observation was taking place. How can a bird learn if it has no sense of self? Why would it realise that if it does what that other bird is doing, it will get cream, if it had no self-awareness.

In parts of the United States there has been a kind of arms race between householders and raccoons which have learned to open trash cans. As more elaborate methods have been used to keep them out, so raccoons have learned to overcome them. In the UK, if you still put bin-bags out and haven't been wheely-binned yet, don't blame the local dogs, cats and foxes for them being ripped open and the contents scattered; in the summer, it's just as likely to have been hedgehogs! And why not? The contents of pet-food tins and pieces of pizza are just as filling as slugs, snails, earthworms and woodlice.

Look closely!
And so gradually, another cherished myth given to us by religion and which has so badly damaged our view of the natural world and our position within and part of it, has been eroded by science and has now all but gone. Very clearly, other animals have consciousness and a sense of self.

Man is a unique species without doubt, which is why, like all other species, science gives us a unique classification, and so we have features which make us unique, but having consciousness and a sense of self-awareness are not amongst them. Nor is intelligence per se, though we may have an especially well-developed form of it, just as elephants have an especially well-developed nose, though no one would give them semi-divine status because of it, save perhaps a superstitious elephant.

The observable facts once again fail to support the notion that Man is the special creation of a god and not just another evolved mammal. All the evidence supports the theory that man is the product of evolution with common descent and has a body plan which is a 'merely' a variation on the basic mammalian theme.





submit to reddit


Science and Religion. Pity the Poor Theologians.

Just came across this paragraph in "Science and Religion. A Very Short Introduction" by Thomas Dixon.

Pity the poor theologians! They are faced with a seemingly impossible dilemma when it comes to making sense of divine actions in the world. If they affirm that God does act through miraculous interventions in nature, then they must explain why God acts on these occasions but not on numerous others; why miracles are so poorly attested; and how they are supposed to be compatible with our scientific understanding of the universe. On the other hand, if they deny that God acts through special miraculous interventions, then they are left with a faith which seems to be little more than Deism - the belief that God created the universe but is no longer active within it. If God is real, should we not expect to be able to discern at least some special divine acts? The theologian seems to have chosen between a capricious, wonder-working, tinkering God and an absent, uninterested, undetectable one. Neither sounds like a suitable object for love and worship.

Dixon, Thomas; Science and Religion. A Very Short Introduction, IBSN 978-0-19-929551-7.

Well, quite!

So, theists, which is it? Is your god a wonder-working, capricious, tinkering god, or an absent, uninterested and undetectable one?

Or, which makes far more sense, and removes any need for inventive mental contortions and logical absurdities, is it just a non-existent one?

(Incidentally, if you wish to buy this book from Amazon and do so through this blog site, any commission I get will go to Oxfam to help ameliorate some of the appalling conditions in which people live and die in this world, with or without its interventionist/non-interventionist/absent gods)





submit to reddit




Income from ads will be donated to charities such as moderate centre-left groups, humanist, humanitarian and wildlife protection and welfare organisations.



Wednesday, 25 January 2012

Not Good With God

So you thought religion was a GOOD thing?

Infant mortality, homicide, income inequality, child well-being, prison population. All adversely affected by belief in god(s).

Oh! And of course, the more religious a society is, the less likely the people are to accept science, especially evolution.

Friday, 20 January 2012

Christians For Genocide - Again

In an astonishing development, and apparently stung by the success of the Atheist Humanist community in exposing the repugnant views of Christian apologist, William Lane Craig, he has launched a counter-attack, and has promptly dug himself even deeper into the hole he created for himself earlier. One wonders if it's kind to keep handing him a bigger shovel.

I have blogged previously on this here, here and here.

To recap:

William Lane Craig originally sought to gain academic respectability by trying to share a platform with leading Atheist, Humanist and evolutionary biologist, Richard Dawkins to debate the existence of gods. Dawkins refused to share a platform with a person who had previously sought to defend the Canaanite genocide and child murder as described in the Bible, and had said so in a Guardian article.

Unbelievably, Lane Craig had explained that:
  • Genocide is not wrong if you believe a god has ordered it. In fact you have a moral duty to carry it out.
  • Child murder is not wrong because it makes them happy.
The only problem he had with the biblical story was the traumatic effect having to murder women and children might have had on the poor soldiers who had had to do the killing. No! Honestly!

The article in which he 'explained' this can be read here

Where Creationists Get Confused.

Darwin's sketch of part of the tree of life
Creationists, either disingenuously, or because of genuine ignorance, seem to have missed the whole point of taxonomy, so they continually make idiotic mistakes which, even though they might imagine them to be valid arguments against evolution, are recognised by those who understand the subject as evidence only of their ignorance. And, with so much information readily and freely available, this ignorance can ONLY be either deliberate or feigned. No one remotely interested in the subject has any excuse for their level of ignorance.

The point of taxonomy is to classify all organisms into a hierarchical system of relationships starting at the lowest level and working up through various levels of increasingly close relationships, ending with recognised and defined sub-species and varieties. These classifications are as man-made as are the political boundaries on maps. Simply drawing a line on a map does nothing to the land either side of that line. The geology itself is completely unaware of the line and feels no compulsion to conform to it.

Species are defined in broadly utilitarian terms and often it's a matter of differing opinion about whether this population or that is actually a distinct species, a sub-species, or a variety, and sometimes it's not clear even into which genus a species should be placed. This is even more complicated with plants where hybridization, environmental variants and polyploid varieties are common, especially in some families.

But the point is that it is humans who make these 'rules' of classification and create the groups into which we fit individual species.

Additionally, the rules were originally devised to classify living species. Life was seen as a hierarchy forming a tree-like structure with living species forming the terminal twigs of branches which were themselves branches of main boughs, all branching off a main trunk. In reality, of course, this tree is still growing and has always been growing.

Moreover, many branches don't arise abruptly but gradually diverge from each other, as we can see from the many examples of ring species and clines, so that, if we were to cut a cross-section of branch at any point in its development at different times and tried to classify it, we would see different degrees of divergence, decreasing as we go back in time and increasing as we come forward so that it would become increasingly difficult and meaningless to force any branch into one of the modern classifications. The only solution might be to create a new species into which to place it or give it a sub-specific or varietal status of its own.

If we could visualise the entire tree of life, we would see divergence occurring followed sometimes by re-uniting in some branches, or even one branch meeting and fusing with a near-neighbour. This could happen if populations of a species become isolated for a while and begin to diverge into different races, then come back into contact and interbreed freely to form a single race again, as is happening with homo sapiens today.

So, not only is classification a man-made concept with rules to which nature was not party and feels no obligation to conform but it becomes even more meaningless when used to classify earlier forms of an evolving species. Nature does not read the rule book!

This is why we can laugh at creationists when they come out with such ignorant statements about micro- and macro-evolution and get so confused about classification of ancestral forms of modern species and the supposed lack of transitional forms between a pair of randomly chosen modern species which no one in their right minds would ever expect to see because no one in their right mind would ever imagine evolved into one or the other, or between an ancestral form given the status of a distinct species and a modern form given a different one.

Of course, we can understand those under-educated simpletons who get so confused about this aspect of biology because they simply lack the ability to think for themselves. What is unforgivable is those educated pseudo-creationists (how do they know what to lie about if they don't know the truth?) who make a handsome living out of maintaining this ignorance in their target victims and supplying them with the necessary misinformation with which to pretend to know as much about biology as those who actually do, without going to the trouble of learning any.

Even more unforgivable are those who assiduously maintain their own ignorance by refusing to read anything, like this blog, which might cause them to abandon their cherished beliefs, for these are the people who are quite deliberately and consciously fooling themselves into believing what they know to be false. These will be the ones who are constantly asking what they like to think are the 'killer knock-down' questions of biologists and who then ignore the answers and ask the same questions again next week. You only need to read their sanctimonious condescension and pretence to have greater knowledge than the scientists who spend years learning and researching the subject, to see what they are getting out of their intellectual dishonesty.

I wonder if they really believe they are fooling their imaginary god by being dishonest even with themselves. No one who believes they are being watched over by an omniscient god of truth and honesty who knows our very thoughts, could conceivably believe it is being fooled by dishonesty.  If this god really existed, it would be as ashamed of them as they should be of themselves.

I suppose the parasitic meme of theophobia can induce all sorts of strange irrationality in its sufferers. Once one sets off down the path of irrational belief, all manner of irrationality becomes possible, even essential, to maintain the delusion. Maybe we shouldn't expect anything better from it's victims.





submit to reddit



Wednesday, 18 January 2012

Why You?

Orange and Yellow, Mark Rothko
Like the Anthropic Principle, the deeper you look into it the more you understand.
You are one of the lucky ones because you are alive. You are special. You are unique in the history of the cosmos; so is everyone else, and every other living thing. None of us has existed before and we never will again. Of all the possible humans and all the possible forms of life, only a very tiny fraction will actually exist.

Why can we say this?

Because the process of producing a new individual ensures that the genes get shuffled and there are far more possible combinations of genes than there are humans alive now or have ever been alive, so the chances of producing exactly you, of all the trillions of possible humans, is almost vanishingly small.

And yet, given the nature of human reproduction, once the conditions for one of several million sperm finding and fertilizing an ovum had been created, the likelihood of producing a human being was highly likely. The only thing that was unpredictable was exactly what hand of genes that individual would be dealt by the process.

Monday, 16 January 2012

Easter - Conspiracy or Cock-up?

If we are to believe the Bible, and apparently some still do, we are supposed to believe that the Jesus story was all part of a divine plan. According to whoever wrote the chapter attributed to 'John',

God so loved the world, that he gave his only begotten son that whomsoever believeth in him should not perish, but have everlasting life.

John 3:16

So, the whole thing was planned. God intended for Jesus to be put on trial, condemned to death and executed because, for some reason, in some inexplicable way, this was going to save the world, or at least those who believed the story.

Leaving aside the whys and wherefores of that plan and what passes for the rational thinking behind it, how does the rest of the story stack up in view of it?

Let's just recap the main points:
  • Jesus came to Jerusalem, apparently knowing everything that was going to happen and that the whole thing was planned.
  • He had to be identified to the Roman soldiers by Judas.
  • Simon Barjona, aka Simon Peter, whom Jesus earlier had named as the 'Rock upon which I build my church', then lashes out with a sword and cuts off a centurion's ear.
  • Jesus has to intervene in the fracas and tells Peter off. For some reason, Peter isn't arrested for the assault.
  • Judas is then ostracised by the group and is so mortified by guilt that he tops himself. Jesus does nothing to stop this.

So, if the whole thing was planned, which of Judas and Peter ensured the plan worked?

Clearly, Judas. Peter tried to put a stop to the plan to 'save the world'. Yet we see poor old Judas treated as a pariah and no one lifts a finger to explain to him that he was a key player in the game; that he had ensured the world got saved. And yet Jesus stands by, supposedly fully aware that Judas was just playing out his predestined role, consciously or otherwise, and lets him go down in history as the archetypal traitor; next to Satan, probably the most hated figure in Christendom.

And Peter, who was so badly off message he was in danger of wrecking the whole scheme, is still the 'Rock'; Jesus's chosen successor.

Finally, Jesus himself, if the scribes who wrote the chapters ascribed to Matthew and Mark are to be believed, lost the plot at the end and thought God had forsaken him. Strange that, for the person who was supposedly god himself, but moving on...

Does that stack up to you? Does that sound like a well-managed master plan being run by an omniscient master planner and inerrant judge of character?

It sounds to me more like the plot of a Keystone Cops movie. Either that, or the scribes who wrote this stuff weren't capable of putting a coherent story together and probably never fully understood themselves the story they were supposed to be telling. I suppose the ability to write in those days was no more a guarantee of the ability to think rationally than it is today.

And to think, people kill other people for not believing this stuff, and claim the right to interfere in all aspects of our lives because they do. Should we blame the Bible's authors for the stuff they wrote, when they were probably only doing their best, or should we blame the unthinking and credulous people who believe their nonsense?







submit to reddit


Saturday, 14 January 2012

Ring Species - Evolution in Progress

The natural phenomenon of rings species presents another major problem for creationism, which requires its supporters to believe that there are no transitional forms and that speciation has never been observed. Ring species refute both these notions and so deliver a fatal blow to notions requiring them to be true.

Ring species can be found where a complex of species, sub-species and closely related members of the same genus exist over a large range and where various local varieties or subspecies have evolved to suit local conditions or to adapt to opportunities in local ecological niches. They are a special form of the phenomenon known to biology as a cline, which is where a species gradually changes across a wide geographical range so that an expert can generally recognise roughly where a specimen was from. We see this in many species, especially insects, birds, plants and some mammals. A ring species is a cline where the ends of the range meet to form a ring.

A few examples should illustrate this but a search on Google will yield several more examples.

Friday, 13 January 2012

Something Fishy About Creationism

Map of the East African lakes

East African Lakes
The lakes of East Africa with their diverse populations of a group of related species of cichlid fish provide a superb example of radiating evolution over a very short time scale and so are a major problem for creationism. These fish represent an aquatic version of Darwin's finches, and are, if anything, an even more dramatic example of the way new species arise by evolving into new ecological niches and an example of the very short time-scale over which this can occur. See The root of the East African cichlid radiations.

First a little about the lakes and their geology:

Between 17,000 and 16,000 years ago, towards the end of the last Ice Age, there was a surge of icebergs and glacial meltwater into the North Atlantic which altered ocean currents and changed the weather pattern over the African and Asian monsoon areas, which experienced a resulting mega-drought. Analysis of sediments show that this caused Lake Victoria, Lake Albert and Lake Tana to dry up and disappear.

A similar event 14,000 - 15,000 years ago caused Lake Victoria to dry up again and a subsequent lowering of water levels 5,000 years ago left a small satellite lake, Lake Nabugabo, isolated. So, from this we know how long ago each lake received its founding population of cichlids from their feeder rivers. In the case of Lake Victoria, this was between 14,000 and 15,000 years ago. We also know that the micro-lake, Lake Nabugabo, has been isolated for just 5,000 years. By contrast, nearby Lake Tanganyika is tens of millions of years old and has remained filled for all that time. See AfricaPaleo - FOCUS 1: Lake levels and evolution.

Thursday, 12 January 2012

Deep Time

One of the problems Creationist 'scientists' exploit in their target market is a general ignorance about the age of Earth and the lack of any real appreciation of just how much time has elapsed for evolution to occur in. This is exploited in fallacies like claiming there just hasn't been enough time for the present diversity to have evolved and for the complexity in the higher animals that we see today.

To get some idea of just how much time life has been evolving, try this little analogy, which Richard Dawkins quotes in 'Unweaving The Rainbow':
Fling your arms wide in an expansive gesture to span all of evolution from its origins at your left fingertip to today at your right fingertip. All the way across your midline to well past your right shoulder, life consisted of nothing but bacteria. Multi-celled invertebrate life flowers somewhere around your right elbow. The dinosaurs originate in the middle of your right palm, and go extinct around your last finger joint. The whole story of Homo sapiens and our predecessor Homo erectus is contained in the thickness of one nail-clipping.

As for recorded history; as for the Sumerians, the Babylonians, the Jewish patriarchs, the dynasties of the Pharaohs, the legions of Rome, the Christian Fathers, the Laws of the Medes and Persians which never change; as for Troy and the Greeks, Helen and Achilles and Agamemnon dead; as for Napoleon and Hitler, The Beatles and Bill Clinton, they and everyone that knew them are blown away in the dust from one light stroke of a nail file."
[Later note] Incidentally, it's ironic that Creationists use the fallacious 'not enough time' argument against evolution when it's a fatal flaw in their daft myth of Noah's Ark. This myth requires all the diversity we see in every species now to have evolved at a vastly faster rate than that required by the scientific theory of evolution. In some instances it would require a new variant to have arisen more than once in each generation for this diversity to have arisen in some 4-5000 years from just two (or seven) founder individuals.

Once again we see Creationists actually believing the infantile parody they accuse science of believing, seemingly without realising it.





submit to reddit






Sunday, 8 January 2012

Religion! Mind Your Own Business!

Where do religious institutions get this idea that somehow they should be included in the institutions of government or that our elected representatives should pay them any attention beyond that due to any other member of society? Religious institutions are by their nature, autocratic and undemocratic, even anti-democratic. All are self-appointing, self-interested organisations which exist ONLY for their own aggrandisement and perpetuation.

Few, if any religions have a democratically elected leadership. Few if any of them are accountable to their members for policy and/or doctrine. Almost all of them have a top down structure which is answerable only to itself.

Where then do they get their authority to interfere in government and the right to influence the nature and structure of society? They can't even claim to represent the opinions of their members since they never seek to discover them. Indeed, almost every religious service seems to consist of autocrats telling their members what they should believe.

Thursday, 5 January 2012

Albert Einstein On Religion.

Nauseated by repeated attempts by religious apologists to claim Albert Einstein as one of theirs and so deceive their gullible followers, I reproduce a letter Einstein wrote in German to Erik Gutkind in January 1954, a year before he died. In it, he refutes any suggestion that he believes in anything resembling the Judeo-Christian god.

An English translation:

Princeton, 3. 1. 1954

Dear Mr Gutkind,

Inspired by Brouwer’s repeated suggestion, I read a great deal in your book, and thank you very much for lending it to me ... With regard to the factual attitude to life and to the human community we have a great deal in common. Your personal ideal with its striving for freedom from ego-oriented desires, for making life beautiful and noble, with an emphasis on the purely human element ... unites us as having an “American Attitude.”

Still, without Brouwer’s suggestion I would never have gotten myself to engage intensively with your book because it is written in a language inaccessible to me. The word God is for me nothing more than the expression and product of human weakness, the Bible a collection of honorable, but still purely primitive, legends which are nevertheless pretty childish. No interpretation no matter how subtle can (for me) change this. ... For me the Jewish religion like all other religions is an incarnation of the most childish superstition. And the Jewish people to whom I gladly belong ... have no different quality for me than all other people. As far as my experience goes, they are also no better than other human groups, although they are protected from the worst cancers by a lack of power. Otherwise I cannot see anything “chosen” about them.

In general I find it painful that you claim a privileged position and try to defend it by two walls of pride, an external one as a man and an internal one as a Jew. As a man you claim, so to speak, a dispensation from causality otherwise accepted, as a Jew of monotheism. But a limited causality is no longer a causality at all, as our wonderful Spinoza recognized with all incision...

Now that I have quite openly stated our differences in intellectual convictions it is still clear to me that we are quite close to each other in essential things, i.e. in our evaluation of human behavior ... I think that we would understand each other quite well if we talked about concrete things.

With friendly thanks and best wishes,

Yours,

A. Einstein


Einstein reinforced this in a letter to J. Dispentiere on 22 March 1954, in which he said:

It was, of course, a lie what you read about my religious convictions, a lie which is being systematically repeated. I do not believe in a personal God and I have never denied this but have expressed it clearly. If something is in me which can be called religious then it is the unbounded admiration for the structure of the world so far as our science can reveal it.


Despite this denial, religious apologists continue to claim Einstein was religious. Obviously, it's much safer to claim a dead scientist as one of your own when fewer and fewer living ones are.







submit to reddit




Sunday, 1 January 2012

As A Former Atheist. Don't Give Me That Crap


"As A Former Atheist..." Don't Give Me That Crap!

No, don't worry, I haven't suddenly taken leave of my senses, abandoned logic, reason and rational thinking and 'found God'.

Several time a week you'll see some fundamentalist Christian or Muslim come on to Twitter and claim to have been "an Atheist just like you", or to be "a former Atheist who's found the peace of Jesus/Allah... blah!... blah!... blah!".

And of course, blogs making that claim are ten a penny.

I say they are either lying or have not bothered to understand what Atheism is.

I say that for this reason:

Atheism is NOT just not going to church/mosque or not praying or not reading the local holy book.

I Can't See Any Sane Person Believing This Stuff Nowadays


And I looked, and, behold, a whirlwind came out of the north, a great cloud, and a fire infolding itself, and a brightness was about it, and out of the midst thereof as the colour of amber, out of the midst of the fire.

Also out of the midst thereof came the likeness of four living creatures. And this was their appearance; they had the likeness of a man. And every one had four faces, and every one had four wings. And their feet were straight feet; and the sole of their feet was like the sole of a calf's foot: and they sparkled like the colour of burnished brass.

And they had the hands of a man under their wings on their four sides; and they four had their faces and their wings. Their wings were joined one to another; they turned not when they went; they went every one straight forward.

As for the likeness of their faces, they four had the face of a man, and the face of a lion, on the right side: and they four had the face of an ox on the left side; they four also had the face of an eagle. Thus were their faces: and their wings were stretched upward; two wings of every one were joined one to another, and two covered their bodies.

And they went every one straight forward: whither the spirit was to go, they went; and they turned not when they went. As for the likeness of the living creatures, their appearance was like burning coals of fire, and like the appearance of lamps: it went up and down among the living creatures; and the fire was bright, and out of the fire went forth lightning.

And the living creatures ran and returned as the appearance of a flash of lightning.

Ezekiel 1:4-14

Well, the only thing to say to that is, "I'll have a glass of whatever he was drinking".

Seriously though, I guess people knew little of mental health problems and the effects of substance abuse in those days but, in this day and age, do sane people really hang on every word of people who come out with stuff like that?

Would you follow someone who was ranting this stuff on a street corner near you?

Seriously?

Me neither. I'd assume their medication needed reviewing or they had stopped taking it.

Friday, 30 December 2011

What A Pain: Does God Hate Everything?

So what's the purpose of pain?

In the UK, The National Health Service spent £442,000,000 on pain killers alone last year. In the USA the analgesics market is said to be worth $2,800,000,000, that's $2.8 billion, per annum. Clearly, pain is seen as a major medical problem and something to be overcome, even at considerable expense. Most people can imagine few things more distressing than constant chronic pain.

How many times have you heard piously self-righteous Christians and Muslims gleefully telling those who disagree with them that they can expect an eternity of pain and suffering for doing so? Suffering eternal pain seems to be the worst thing at least some humans can imagine.

There seems to be nothing to be said for pain at all. Yet we even have specialised nerve endings for feeling pain and centres in our brains for processing the information they provide and turning this into the conscious unpleasant experience we call pain. Indeed, the normal responses of our bodies to injury often seem designed to INCREASE the pain of injury.

So why have we evolved the ability to feel pain?

Put simply, pain tells us something is wrong. Pain draws our attention to injury or disease. Pain says do something or don't do something; guard me, rest me or don't use me. Don't walk on that broken ankle because it needs to be rested. Don't carry on with that chest pain but slow down and take a rest. Don't bite on that tooth or raise that broken arm. Close your eyes and sleep when that headache becomes unbearable. Put your hand over your ear when cold wind makes it ache and change your shoes when that blister bursts...

Pain even initiates reflexes which happen before our brains have noticed. These spinal reflexes have evolved to protect various parts of our bodies and pain is the signal to act automatically without the normal luxury of thinking about it first.

Pain has evolved as a signal. It is unpleasant because that tells us to try to stop it by resting or guarding the hurting part of our body. Pain is unpleasant because we have evolved to perceive it as unpleasant. Being unpleasant means we do something about it to reduce the unpleasant sensation.

Consider a patient dying in extreme pain of cancer, or an abscess, or a disabling injury in the absence of any pain relief? What possible purpose could that serve the individual?

Consider a gazelle dying of the shock of having it's intestines pulled out and its liver eaten by lions whilst still alive, or the zebra having a leg torn off by a crocodile as it is slowly drowned.

How does pain serve these individual?

Nature is unemotional and entirely lacking in compassion. Nature doesn't care about the suffering of a prey species as it is eaten and yet we can be quite sure that every sentient creature, and probably many others, feel pain. Nature has no concern at all for the discomfort or distress of an animal suffering from infection or dying of disease or simply starving to death of old age.

The fate of almost every living multi-cellular thing is to die of disease, or by being eaten, or of starvation due to injury or old age. There are very many ways to die and none of them are pleasant. Millions of feeling animals die every day in great pain. A system which has evolved to keep you alive is useless when you are dying, and yet it is still demanding you do something even when there is nothing you can do.

So why should we have evolved something we don't like and why would it be at its most insistent when at its most useless? What intelligent designer would design such a thing?

Because evolution isn't driven by what we like or dislike; evolution is driven by whatever ensures we have more descendants than we would otherwise have. Evolution is determined by what is in the interests of our genes because it is our genes which either survive in the next generation, or don't. And there is no benefit to our genes in evolving a mechanism to turn pain off when it is no longer any use.

So, evolution has provided us with something we don't like, and this is perfectly understandable in terms of mindless, unemotional, uncaring, genetic evolution.

What is not understandable is how this could have been designed by an intelligent, loving, caring and compassionate god. If pain has been designed by a god then that god must be a stupid, cruel, sadistic and hateful god.





submit to reddit




Thursday, 29 December 2011

Jesus - History or Hoax?

This blog is derived from a Tweetlonger tweet by @dawkinsassange in reply to @tndan who cited Christianity: HOAX OR HISTORY by Josh McDowell as 'proof' of the historicity of Jesus.

I reproduce it here as a refutation of that book and of the many fallacious and inaccurate claims contained in it.

My thanks to @dawkinsassange for permission to reproduce it.

Pgs. 38-39 Appeal to Authority fallacy. Answered in this link.

Pgs. 40-41 No contemporary evidence of Apostles (earliest 150 AD)

Pgs. 41-44 Guilt by association fallacy & faulty analogy. The Watergate conspirators were not being promised eternal rewards in heaven. If these martyrs existed, I have no doubt they BELIEVED, which is irrelevant to actual events.

Pgs. 45-46 Appeal to Authority fallacy

Pg. 47 "Strong evidence that the NT written at an early date" not supported in text. Only assertions.

Pg. 48 "Oral tradition not long enough.." Proof? Evidence?

Pgs. 49-51 So there's no originals. Therefore unknown numbers of errors.

Pgs. 52-54 Much of the NT was admitted to be hearsay. The writer of Mark's confusion with Palestinian geography is circumstantial evidence that Mark wasn't there.

Pgs. 54-55 The contradictions between NT writers indicate lies.

Pgs. 55-58 An alternative explanation that doesn't include miracles is that it is all legendary.

Pgs. 58-59 Writers a hundred years after the event don't add a lot to historicity. In fact, there were many contemporary writers who never attested to Jesus.

Pgs. 59-60 Luke doesn't agree with Josephus.

Pg. 60 "One test of a writer is consistency" Agreed. Luke fails.

Pgs. 61-62 The same standard must be set to the Bible as other secular literature. No. Extraordinary claims require extraordinary proof. Otherwise it must be treated the same as other ancient records of legends such as Hercules.

Pgs. 62-63 Criterion of embarrassment argument. Limited in application and not proof that the event happened as described. May be used to fit writer's theology.

Pgs. 65-69 I felt the same joy when released from indoctrination.

Pgs. 73-79 Preaching and selling stuff.

Pgs. 81-83 Disagree. Bible is consistent only in it's inconsistency. It shows every indication of being written by ancient superstitious people.

Podcasts by Peter Coote (@cootey59) also dealing with this may be heard here.

Hoax or History? I vote Hoax

[Yet to be added: Josh McDowell's reply.]

[Further update: despite repeated invitations spread over several weeks, Josh McDowell failed to reply or even acknowledge the invitations.]





submit to reddit




Income from ads will be donated to charities such as moderate centre-left groups, humanist, humanitarian and wildlife protection and welfare organisations.

Tuesday, 27 December 2011

The Depths To Which Christians Will Sink


Antony Garrard Newton Flew
(11 February 1923 – 8 April 2010)
Antony Flew Considers God...Sort Of:

An exposé of the claim that Anthony Flew became a Christian by historian Richard Carrier.

Worth the long read to see the depths Christian apologists will go to to keep their market intact and their income stream flowing.


And more in Anthony Flew's Bogus Book, by the same author.
My thanks to @jablomih on Twitter for providing me with the link. In his words, "Can you imagine atheists circling William Lane Craig's deathbed looking for a "conversion"? Or lying & saying he had one?"

When you show the world you know you need to lie for your cult, you show the world you know your cult is for fools who'll believe falsehoods.

Saturday, 24 December 2011

Are The Bible's Publishers Breaking The Law?


In England we have the Serious Crimes Act 2007 Part 2 of which came into force in 2008. Section 59 removed the Common Law offence of incitement and replaced it with the criminal offence of Encouraging or Assisting Crime defined as:

Section 44. Intentionally encouraging or assisting an offence.

Section 45. Encouraging or assisting an offence believing it will be committed.

Section 46. Encouraging or assisting offences believing one or more will be committed.

It would be astonishing if other civilized countries didn't have similar laws.

So what has this to do with the Bible?

For every one that curseth his father or his mother shall be surely put to death: he hath cursed his father or his mother; his blood shall be upon him.

Leviticus 20:9

Incitement to commit murder.

And the man that committeth adultery with another man's wife, even he that committeth adultery with his neighbour's wife, the adulterer and the adulteress shall surely be put to death.

Leviticus 20:10

Ditto.

And the man that lieth with his father's wife hath uncovered his father's nakedness: both of them shall surely be put to death; their blood shall be upon them.

Leviticus 20:11

Ditto.

And if a man lie with his daughter in law, both of them shall surely be put to death: they have wrought confusion; their blood shall be upon them.

Leviticus 20:12

Ditto.

Thursday, 22 December 2011

Foolish Jesus And The Ravening Wolves

Browsing casually through the KJV Bible today, I came across these curious passages.

According to Matthew, Jesus tells a tale about a wise man building his house on rock and a foolish man building it on sand. He then prophecies that a house built on rock won't fall down but one built on sand will.

Therefore whosoever heareth these sayings of mine, and doeth them, I will liken him unto a wise man, which built his house upon a rock: And the rain descended, and the floods came, and the winds blew, and beat upon that house; and it fell not: for it was founded upon a rock.

And every one that heareth these sayings of mine, and doeth them not, shall be likened unto a foolish man, which built his house upon the sand: And the rain descended, and the floods came, and the winds blew, and beat upon that house; and it fell: and great was the fall of it.

Matthew 7:24-27

Well, that's pretty obvious really. It doesn't take a genius to come to come up with that, does it?

But what's this a little later on?

Matthew then tells us this curious tale:

And Simon Peter answered and said, Thou art the Christ, the Son of the living God. And Jesus answered and said unto him, Blessed art thou, Simon Barjona: for flesh and blood hath not revealed it unto thee, but my Father which is in heaven. And I say also unto thee, That thou art Peter, and upon this rock I will build my church; and the gates of hell shall not prevail against it.

Matthew 16:16-18

Hmm... so Matthew has Jesus choosing Simon Barjona as the rock upon which to build his church. Note the use of the singular there; "my church", not "my churches". He also has Jesus prophesying that "the gates of hell shall not prevail against it". Again the singular 'it'.

But what happened to this church? How did that prophecy turn out?

Is there just one true church?

Clearly not. Apart from the major schisms between the Roman and Orthodox Church, there are also the earlier schisms between the Coptic, Armenian and Maronite Christian churches, the Cathars, the Paulicians, Lollards, Hussites, etc. Then of course the various other schisms like that between the Catholic and Protestant churches.

And then the storm really hit. The Protestant church almost immediately fragmented into all the various sects like Lutherans, Calvinists, Quakers, Presbyterian, Baptist, Anabaptist, Seventh Day Adventist, Methodist, Anglican or Episcopalian, etc, etc, etc, and the Baptist sect alone promptly shattered again into a myriad different churches so that today we have some 40,000 different churches, all claiming to be the one true church and, at least by implication, that all the others are false, and therefore Satanic.

Ravening Wolf
The One True Church Jesus built on Simon 'The Rock' Barjona has shattered like grains of sand, and the gates of hell seem to have prevailed against it, if you believe all the present churches, that is.

Curious how all these modern-day priests seem to want their 'flock' to believe that Jesus was a foolish man, a false prophet and a poor judge of character in his choice of Simon, and that the Gates of Hell have indeed triumphed over Jesus' church, eh?

Or was Matthew up to something when he made up those tales?

What's that you say, Matthew?

Beware of false prophets, which come to you in sheep's clothing, but inwardly they are ravening wolves.

Matthew 7:15

Hmm... so beware of Jesus, the ravening wolf clothed as a lamb, eh?

Blimey! Subversive, or what!? You'd have thought the Bible's editors would have picked that one up.

I'm glad I'm not a Christian so I don't have to work out ways to ignore this sort of hopeless muddle.







submit to reddit





Wednesday, 21 December 2011

Talking Turkey

I heard an interesting thing today. At least I find it interesting.

Apparently, in the fifteenth century, Turkish traders started supplying England with the helmeted guinea fowl, Numida meleagris, a bird found wild in East Africa which had been domesticated there for about 4000 years and was so named because of the strange bony structure it has on its head.

It had been introduced by the Romans 1400 years earlier, but had been lost with the collapse of the Roman Empire.

These traders were known as Turkish or Turkey Traders and, by the sort of popular misunderstanding which helps create new words in a language, these birds became popularly known as turkeys. They were a popular meat at Christmas because they tasted good and had a fair amount of meat on them.

Later, when the distantly related wild bird, Meleagris gallopavo, now know as the turkey, was introduced from the New World, because it looked and tasted a bit like the 'turkey' it was mistakenly also called a turkey. As the helmeted guinea fowl fell out of favour, the name transferred to the New World bird.

So, a New World bird came to be known indirectly by the same name as a country with which it had absolutely no direct connection.

Like so much else with the European Yuletide, midwinter festival onto which the Christian Nativity myth has been grafted because the church couldn't bear being left out, turkeys have nothing to do with the Bible stories on which the myths are based.

Nor do holly, ivy, mistletoe, plum puddings, mince pies, dates, figs, the giving of gifts or even the season of goodwill to all men, wassailing and yule logs.

Have a Cool Yule.





submit to reddit



Tuesday, 20 December 2011

Evolution - The Meaning of Information


Go to any creationist website and you will find any number of 'creation scientist' explaining to their credulous and gullible readership and potential customers that information theory proves that no new information can arise by a random process, or some such half-baked notion, so the Theory of Evolution must be wrong (so a magic man magicked everything and it must have been the locally popular one, obviously, as eny fule kno).

Where do they get these ideas from?

Mutations in DNA are relatively common because the copying process is not perfect, despite the mechanisms which have evolved to correct them.

I'll not go into the so-called genetic code here because, with a few clicks on Google, or by opening any of very many books on the subject, this can be easily found by those who wish to know more. Those who don't won't have bothered reading this far.

If anyone can tell me why a mutation which changes the genetic code for a small portion of a given enzyme from, let's say, UUAUAUCAUGUAGAUAACCCCUGA to UUAUCUCAUGUAGAUAACCCCUGA in the short sequence of mRNA, is prohibited by the second law of thermodynamics, I'd be very grateful...

Sunday, 18 December 2011

If God Wants Us To Believe In Him

If the Judeo-Christian god want us to believe in him, why doesn't he:
  1. Do to each of us what he allegedly did to Saul on the road to Damascus?
  2. Become incarnate and perform public miracles at every generation, as he allegedly did to Moses and as Jesus?
  3. Spontaneously appear and end a famine, stop a war, cure a disease or prevent a natural disaster?

Why didn't he:
  1. Create a universe, solar system and life on earth in such a way that it is totally unexplainable by science, and leaving him as the only possible explanation above all other possible gods?
  2. Create life on earth so that it cannot be explain by ideas of common descent and divergence; so that comparative anatomy and physiology can find no connections or similarities between different species; that there are no classes intermediate between fish and mammals, or similarities between humans and other life forms; that each species had an entirely different genetic code, or no code at all; with no fossil evidence suggesting an evolutionary process with regular extinctions?
  3. Create a flat earth so it could not be logically explained any other way than by divine creation?
  4. Create an earth with no geological evidence suggesting it is very old and has formed by a dynamic process over a very long time?
  5. Created an earth with no evidence of unintelligent design?
  6. Created a monument to Abraham which could be accurately dated?
  7. Arranged for there to be archaeological and independent historical evidence of the Exodus, the wandering of the Israelites in Sinai, the destruction of the Canaanites, the massive economic collapse of Egypt following the plagues and the loss of it's slave population, etc?
  8. Left unarguable evidence of a universal flood and made remains of Noah's Ark easy to find and validate?

Why doesn't he:
  1. Make Christians nicer people who actually do what they tell others they should do?
  2. Answer prayers in ways too obvious to be disputed, making Christians people we can go to to get our problems sorted by prayer?
  3. Produce evidence that prayer works so that scientific studies would always show overwhelming evidence of their efficacy?
  4. Create a single, world-wide religion?
  5. Predict future events precisely so that we can see clearly the validity of the prediction?
  6. Create a religion which, unlike all other known religions, is not disbelieved by a majority of the world's people?

In short, why doesn't the Judeo-Christian god seem to want people to believe in him?

For more on this, see John W. Loftus, "Why I Became An Atheist"





submit to reddit




Income from ads will be donated to charities such as moderate centre-left groups, humanist, humanitarian and wildlife protection and welfare organisations.

Oops! Another Bible Blunder

Thus saith the LORD of hosts, the God of Israel; Put your burnt offerings unto your sacrifices, and eat flesh. For I spake not unto your fathers, nor commanded them in the day that I brought them out of the land of Egypt, concerning burnt offerings or sacrifices: But this thing commanded I them, saying, Obey my voice, and I will be your God, and ye shall be my people: and walk ye in all the ways that I have commanded you, that it may be well unto you.

Jeremiah 7: 21-23



And the LORD called unto Moses, and spake unto him out of the tabernacle of the congregation, saying, Speak unto the children of Israel, and say unto them, If any man of you bring an offering unto the LORD, ye shall bring your offering of the cattle, even of the herd, and of the flock. If his offering be a burnt sacrifice of the herd, let him offer a male without blemish: he shall offer it of his own voluntary will at the door of the tabernacle of the congregation before the LORD. And he shall put his hand upon the head of the burnt offering; and it shall be accepted for him to make atonement for him. And he shall kill the bullock before the LORD: and the priests, Aaron's sons, shall bring the blood, and sprinkle the blood round about upon the altar that is by the door of the tabernacle of the congregation. And he shall flay the burnt offering, and cut it into his pieces. And the sons of Aaron the priest shall put fire upon the altar, and lay the wood in order upon the fire: And the priests, Aaron's sons, shall lay the parts, the head, and the fat, in order upon the wood that is on the fire which is upon the altar: But his inwards and his legs shall he wash in water: and the priest shall burn all on the altar, to be a burnt sacrifice, an offering made by fire, of a sweet savour unto the LORD.

Leviticus 1:1-9

So which of these is the truth? Is the account in Leviticus 1 of God talking to Moses concerning burnt offerings, correct, or is Jeremiah right to say that God did NOT give any such command?

Or are we expected to just believe two mutually contradictory things simultaneously in order to believe that the Bible is the word of a god, and not a poorly edited and inconsistent collection of various writings of different people following different agenda at different times?





submit to reddit




Web Analytics