Eric Hovind's Very Silly Questions

I'm not sure who they're aimed at - not people of normal intelligence, that's for sure - but these astoundingly facile questions are what Eric Hovind believes are killer knock-down questions for non-Christians. (Apparently Eric is either genuinely unaware that other religions offer answers to all these, or is feigning ignorance and relying on his target audience's ignorance to get away with it).

Eric is the son and chief acolyte of his father, the notorious liar and grifter, Kent Hovind, and was caretaker of the family 'business' while Kent was serving jail time for tax fraud and again for a violent assault on his former wife. Little Eric seems to be very much a chip off the old block-head

He is ignorant of, or is feigning ignorance of, the answers to several of these questions which can be found by a moment's search on the Internet, or by going to a decent reference library or any good bookshop.

The originals can be seen here: http://www.drdino.com/questions-science-cant-answer/. In the best traditions of the snake-oil peddler, they are nothing more than the God of the Gaps, gotcha! questions where the target marks are expected to not realise they are nothing more than the argument from ignorant incredulity combined with the false dichotomy fallacy. Eric assumes the targets can be relied on to assume, if science hasn't answered something, science won't ever answer it, so, since the only alternative is "God did it!", that wins by default. This saves the fraud the trouble of producing any evidence to support his/her contention, and taps into the parochial ignorance, scientific illiteracy and cultural chauvinism of his target audience.

This is the hallmark of the dishonest, intellectually bankrupt creationist apologist.
Let's take a look at them (in red)

Coming Soon - Your Story!

Several years ago I wrote a blog post based on a much earlier post I originally put in a CompuServe Forum (who remembers those?). It told the story, as I then understood it, from the Big Bang to the evolution of modern humans. I called it What Makes You So Special?

When I promoted it on Twitter it sent several fundies into a frothing rage but the reaction I got from the science and especially Atheist community was surprising. One person said it made her cry and she kept reading it over and over. Another said he's printed it out and given it to his grandson to read. A third said it had changed her life.

Several said I should add more detail and make a book out of it...

That idea had been gestating for several years, and had even suffered one false start. Now it is nearing fruition: I am about to publish the book!

The book is aimed at the curious; at those who want to know and understand a little more about how they got to be alive, here and now and who find mystery and magic wholly unsatisfactory answers.

Why You?

Orange and Yellow, Mark Rothko
Like the Anthropic Principle, the deeper you look into it the more you understand.

You are one of the lucky ones because you are alive. You are special. You are unique in the history of the cosmos; so is everyone else, and every other living thing. None of us has existed before and we never will again. Of all the possible humans and all the possible forms of life, only a very tiny fraction will actually exist.

Why can we say this?

Because the process of producing a new individual ensures that the genes get shuffled and there are far more possible combinations of genes than there are humans alive now or have ever been alive, so the chances of producing exactly you, of all the trillions of possible humans, is almost vanishingly small.

And yet, given the nature of human reproduction, once the conditions for one of several million sperm finding and fertilizing an ovum had been created, the likelihood of producing a human being was highly likely. The only thing that was unpredictable was exactly what hand of genes that individual would be dealt by the process.

Why Should I Not Be An Atheist?

Okay, here's your big chance. Tell me why I should not be an Atheist.

You see, I'm an Atheist because I have no reason not to be. Atheism is simply the default state in the absence of any reason to believe in a god. From the time at the age of nine, when I realised there was no more reason to believe in the locally popular god than there was to believe in any other god, I realised I had no reason to believe in the locally popular god either. Being an Atheist wasn't a conscious decision; being an Atheist is simply the consequence of not having any reason not to be one.

Now, you can change all that. All you have to do is to tell me what it is that convinces you that there is a god and what convinces you that it is your particular god. This has to be something I can verify for myself so don't just expect me to take your word for it. I never took the word of my parent's, my grandfather, my uncles and aunts, the local vicar, the headmaster of my school, my close Muslim friend, my Christian fundamentalist work colleague or of my devoutly Catholic assistant when I was a departmental manager, so I won't take your word for it either.

Just a few things to remember, though:

Creationists! Test Your Personality With This Simple Test!

Find out what makes you a creationist with this simple personality analysis.

Just note down the letter of the answer that comes closest to your reaction to everyday online experiences. No scientific knowledge is needed and you don't even need to know your holy book. Just be as honest as you can.

What could be simpler?

1. When you see the word 'evolution' in an online debate do you:
   
   1. Start typing stuff about the Big Bang, Atheism, life from nothing and evolution being a religion?

The Probability Of Being

What was the probability of you existing at all?

For it to happen, for as many generations are their have been human generations, and for as many generations as there has been life, every single one of your ancestors needed to meet exactly the right mate at exactly the right time and to produce one of your ancestors with exactly the right combination of genes. In each generation the right sperm needed to fertilise the right ovum.

And if any one of these had been different, you would not exist.

So how to calculate the probability of you existing? Don't bother to do the math; the result is so small that it would have more zeros after the decimal point than there are elementary particles in the universe.

And yet you exist.

Isn't this evidence of a controlling force; some intelligence running things? How can something so hugely improbable happen at all? Well no. That view only makes any sense if you assume the purpose of everything was to produce you.

The Universe Is A Zero Sum Game

One question which seems to baffle creationists most is how can you get a Universe from nothing. I'm going to explain that now, so if you're a creationist who values your ignorance because it makes you think asking questions like that means you are cleverer than scientists who obviously have never thought of that before, stop reading now.

Ignoring the obvious questions, "How can you get a god from nothing, and what did it make everything out of when there was nothing to make it from?" creationists settle for the most infantile of all 'answers', "It must have been magic!". And of course it goes without saying that there must have been a magic man to do the magicking and that magic man must have been the locally popular one that mummy and daddy told them about.

This comes from the arrogant assumption that the Universe should be easy to understand without needing to learn anything and from the resulting ignorance about the nature of the Universe and in particular that the Universe is actually made not of 'stuff' but of energy. 'Stuff' is made of energy, as Einstein showed. Everyone can quote Einstein's e = mc² and yet creationists in particular seem incapable of understanding what it means.

e = mc² is the relationship between energy and matter and shows how they are the same thing. In fact, it shows that matter is simply a form of energy. 'c' being the velocity of light, which is very large, means that it takes lots of energy to make a small amount of matter and a little bit of matter contains lots of energy. Basically, that's why atom bombs are powerful.

So where did all this energy come from and why does it show how you get a Universe from nothing?

Well, the Universe appears to be made of four fundamental forms of energy which manifest as four basic forces:

1. The Strong Force - which can hold a nucleus together against the enormous forces of repulsion of the protons.
2. The Electromagnetic Force - manifests itself through the forces between charges and the magnetic force. Fundamentally, both magnetic and electric forces are manifestations of an exchange force involving the exchange of photons.
3. The Weak Force - a force involving exchange of elementary particles in the atomic nucleus.
4. Gravity - an attractive force proportional to the mass of an object.

Both the strong and weak forces have a very short range, while the electromagnetic force and gravity have a theoretically infinite range, but the important thing for understanding the fundamentals of where the Universe came from is that the first three in this list together total the force of gravity. Gravity is a negative force totalling the sum of the other three forces.

Gravity is actually a very weak force but it acts over a theoretically infinite distance. Consider Newton's apocryphal apple clinging to it tree by the nuclear forces holding the molecules of its slender stalk together and yet able to resist the entire gravitational force exerted by Earth. Yet everything that has mass has gravity so the sum total of the Universe is, well, massive.

One explanation for what happened in the initial 10^-43 seconds is that a quantum fluctuation large enough for relatively weak gravity to become stripped away from the other three forces and 10^-43 seconds was enough for this to cause a hyperinflation in which almost unlimited positive and negative energy could be created but always totalling zero. This Plank Time is the minimum time that can exist so the instant the Universe came into existence, it was immediately 1*10^-43 seconds old.

The sum total of all the energy in the Universe is zero.

The Universe is literally nothing. Not something, but nothing has come from nothing!

It's a bit like borrowing from a bank. The Bank lends you $1000. You now have $1000; the Bank has -$1000. You both have an asset which you can use (the Bank can actually sell your debt as an asset because it represents a bit of your future earning that the bank now owns and you can use the $1000 for whatever you borrowed it for) and yet no wealth was created by that transaction.

What followed after this initial 10^-43 seconds is now very well understood and can be read in the first part of my blog, What Makes You So Special?

So when creationists ask how the Universe came from nothing, all they do is betray the ignorance upon which their superstition depends. That they are primed to ask these sorts of questions by the pseudo-scientists who feed them this ignorance in return for money speaks not so much of their credulous gullibility as of the criminal dishonesty of those cheats who sell them the stuff.

---

What Makes You So Special?

Your Story

[Edit. This article has now been greatly expanded into my book, What Makes You So Special? : From the Big Bang to You, available in paperback or ebook for Kindle]

Bear with me a while because yours is a long story but it's a story very much worth telling.

About 13.7 billion years ago the universe came into existence as a singularity. We know this because the universe is expanding in all directions at a measurable rate. Projecting this backwards leads to a time when the entire universe occupied a single point of nearly infinite density; a black hole or singularity.

We also know that time and space are part of the universe and do not exist independently of it, so there is no sense in which we can talk of where and when this singularity occurred in some pre-existing space-time dimension.

A Christian Guide to Making Your Wife Have Sex

Wholesome Christian husband using God-approved moral blackmail to force sexual compliance.

In a bid to understand the fascination of fundamentalist Christians with Donald Trump, and especially with their apparent admiration for his seduction technique, I thought I would conduct a little research into Christian teaching on bedroom matters, and in particular the approved gender roles within a marriage.

Remember, Donald Trump's seduction technique, and one of the qualities that so endear him to fundamentalist Christians, is to grab a passing woman by her 'pussy' and expect her to become uncontrollably aroused at the thought of his large wealth. So how does this fit in with current Christian teaching? For this I turned to the fundamentalist Christian blogsite, Biblical Gender Roles.

What A Waste Of A Life - Grovelling To God!

What's with this idea that somehow belief in gods gives your life a purpose? What is it that induces otherwise normal people - at least I'll assume they are in the absence of evidence to the contrary (though I concede that these tweets may indeed be that evidence) - to tell the world this sort of thing?

Creationism in Crisis - More Evidence of The Positive Psychological Benefits of Awe-Inspiring Science - No Religion Required

Awe-inspiring science can have a positive effect on mental wellbeing, new research finds - Press Releases

Creationists and other religious fundamentalists claim a monopoly on 'spirituality', for example this article on a Jehovah's Witness (aka, liars for Jesus) website which claims you can't be spiritual without believing in their god.

Unbelievably, they cite the Bible in support of that claim, not any real-world observations, experiments or surveys.

However, many scientists, not the least of which are Richard Dawkins, Albert Einstein and Carl Sagan, cite an understanding of science as a source of deep spirituality, a sense of awe and wonder, of oneness with the world and a genuine perspective and appreciation of being alive.

Indeed, my book, What Makes You So Special: From the Big Bang to You is intended to give the reader this sense of awe and wonder from a basic understanding of the scientific processes that led from the Big Bang to the reader's existence here and now, and concludes with the following:

Your journey through space and time has been an adventure of disasters, adaptation, survival and recovery, many, many times you will have been on the brink of extinction - the fate of 99% of all known ancient species - yet your ancestors survived and because they were good at surviving you are here and now. You will live for a mere flash in the time-scale of the Universe but in the vast darkness of the cosmos there can surely be few flashes as bright as your bright spark of consciousness.

Be proud. Be very proud. But at the same time be humbled by the enormity of the events which produced you and the fragility of it all.

Stars died and because they died, you live. You are made by stars out of stardust and in a very real sense; because you are made of the same stuff the Universe is made of and are a part of it, there is something even more wonderful about you. Through you, though not just through you, and maybe not just here on this small planet, the Universe has gained self–awareness and can begin to understand itself.

Through you it can stand on the surface of this beautiful little jewel in the cosmos, can look up in awe at itself and think "Wow!"

You are special. You are unique and you were nearly 14 billion years in the making.

That is your story. Enjoy it while it lasts.

Rosa Rubicondior, What Makes You So Special, page 152

And perhaps Carl Sagan said it better and more succinctly with:

When we recognize our place in an immensity of light years and in the passage of ages, when we grasp the intricacy, beauty and subtlety of life, then that soaring feeling, that sense of elation and humility combined, is surely spiritual.

Carl Sagan, (2011). The demon-haunted world: Science as a candle in the dark. Ballantine Books. (Original work published 1996)

And of course, as Albert Einstein famously said in a letter to J. Dispentier, when refuting false claims that he was a theist or even a Christian:

It was, of course, a lie what you read about my religious convictions, a lie which is being systematically repeated. I do not believe in a personal God and I have never denied this but have expressed it clearly. If something is in me which can be called religious then it is the unbounded admiration for the structure of the world so far as our science can reveal it.

Albert Einstein. Letter to J. Dispentiere, March 24, 1954 Source: Wikipedia - Albert Einstein's Religious Views.

And now we have experimental evidence from psychologists that science can be a source of spiritual experience, with all the psychological benefits, as some people claim religion to be. The paper, reporting on three linked studies, by researchers at the Department of Psychology at the University of Warwick, UK, is published open access in Personality and Social Psychology Bulletin, and is explained in a Warwick University press release:

Science Has Confirmed a Theory Explaining the Large-Scale Structure of the Universe

Optical image of the Abell 3391/95 system

© Reiprich et al., Astronomy & Astrophysics

Longest intergalactic gas filament discovered — Universität Bonn

I don't normally write about cosmology and astro-physics because they are not subjects in which I have any particular expertise but the findings of a team of researchers from Bonn, Germany, are interesting from a general science point of view in that they confirm our ideas about the early formation of the Universe are correct. It's also good to have a theory I described in What Makes You So Special? From the Big Bang To You confirmed by science.

In particular, the scientists confirm models which explain why the Universe is grainy, with stars, galaxies and super-clusters, and not smooth and amorphous as a simple understanding of mathematics that ignore quantum fluctuations seems to predict.

In this simplistic model, atoms should be evenly distributed so there would be no reason for gravity to pull it into clumps to form denser regions. However, small differences produced by quantum fluctuations should produce small areas of increased density where gravity was higher than the surrounding space, so nearby matter would tend to move towards these centres.

Computer simulations predict that this would leave the Universe looking somthing like a sponge with large 'empty' spaces connected by thin filaments of rarified gas forming a basic matrix, and this is exactly what the researchers have found.

Only One Way To Find Out!

What could possible motivate an individual to create multiple accounts with Amazon then use them to obsessively trawl through the book lists putting hostile and defamatory pseudo-reviews on them? Well, as we'll see in a minute, there is no real rational answer for people's irrational behaviour, other than in terms of what causes their irrational behaviour in the first place.

For example, this is what people who have actually read my book, What Makes You So Special: From the Big Bang to You, or who have read other of my books, have said about it:

From Amazon.com

I can't wait for this book to join my collection of Rosa Rubicondior books. All of the ones I have so far have been an easy to read, jaw opening enlightenment for me. I can't believe the research that this writer has done to back up their words in the books I have. I'm truly amazed and can't wait to get this at my door. Thank you Rosa Rubicondior for your knowledge and books!!

---

A great introduction to science and how it relates to everything. Rosa gives a whole new perspective on how everything is connected and related with an infectious enthusiasm. Not some New Age mystical cult woo but solid science. If you don't feel a bit more special, especially after the last chapter, and don't see nature and the world in a different light, then you need to reread it.

Morocco Mystery Man

[left caption]

[Right caption/credit]

A composite reconstruction of what its discovers believe is the earliest known Homo sapiens fossil (from Jebel Irhoud), based on scans of multiple specimens. The scientists say the virtual imprint of the braincase (blue) indicates that brain shape, and possibly brain function, evolved within the H. sapiens lineage.

Credit: Philipp Gunz, MPI EVA Leipzig

The age of the hominin fossils from Jebel Irhoud, Morocco, and the origins of the Middle Stone Age : Nature : Nature Research

The press are having one of those, "The textbooks are going to have to be rewritten" days.

Apparently, the textbooks are not just updated with the most recent findings and understanding when a new edition is published; they have to be rewritten because that one little bit of new information shows that everything we thought we knew was wrong. You sometimes wonder if the science news is written by creationists - except of course that the news media don't then make the absurdly childish leap of concluding that because one little bit of science has been revised this proves the entire body of science is wrong - about everything, so God did it!

But, in this case, the entire evolutionary story of humans now needs to be rewritten, so we are told. You might now be wondering what is this amazing discovery? Humans are not apes? Not African apes, maybe? We've evolved from guinea pigs or spontaneously generated? The truth is slightly more prosaic of course, in fact it barely rates as startling at all - interesting and thought-provoking, naturally, but startling? The 'startling' fact is some archaic human fossil remains including skulls, flint tools and animal remains found in Morocco have been dated to about 300,000 years old and may be the oldest fossil Homo sapiens so far discovered.

So You Think You Don't Believe In Evolution?

It's really very simple.

The problem with creationists is they've been made to believe evolution is either something really complicated and hard to understand, or else it's something really stupid that no sane person could believe, like monkeys having human babies or crocodiles changing into ducks.

It's neither.

In fact it's something so simple that no sane person could not believe it. There are only three things needed for evolution to happen.

1. Inheritance of physical characteristics.
2. Imperfect reproduction of those characteristics to give variation.
3. An environment which favours some variations over others making it more likely they will be passed on to the next generation.

Does anyone seriously doubt any of these? If so which?

Evolution - The Meaning of Information

Go to any creationist website and you will find any number of 'creation scientist' explaining to their credulous and gullible readership and potential customers that information theory proves that no new information can arise by a random process, or some such half-baked notion, so the Theory of Evolution must be wrong (so a magic man magicked everything and it must have been the locally popular one, obviously, as eny fule kno).

Where do they get these ideas from?

Mutations in DNA are relatively common because the copying process is not perfect, despite the mechanisms which have evolved to correct them.

I'll not go into the so-called genetic code here because, with a few clicks on Google, or by opening any of very many books on the subject, this can be easily found by those who wish to know more. Those who don't won't have bothered reading this far.

If anyone can tell me why a mutation which changes the genetic code for a small portion of a given enzyme from, let's say, UUAUAUCAUGUAGAUAACCCCUGA to UUAUCUCAUGUAGAUAACCCCUGA in the short sequence of mRNA, is prohibited by the second law of thermodynamics, I'd be very grateful...

Perfectly Plausible Abiogenesis

I get more than a little bit bored with almost every debate with creationists eventually, and often very quickly, coming down to a demand that we explain abiogenesis, or more likely an assertion that it can't be explained because it's 'impossible'.

Then comes the parrot squawk, "you can't get life from non-life", as though any of them could define this 'life' thing.

So, with that in mind, I thought I would both give a puff for my book, What Makes You So Special? From the Big Bang to You and put on record a perfectly plausible explanation for how abiogenesis could have happened. Note, it's not meant to be an account of how it actually happened, just how it could have happened, to refute creationist claims that it is impossible.

If any creationists wishes to substantiate that claim, please feel free to go through the following ten steps and say which laws of chemistry and/or physics would make one or more of them impossible. If you can't, clearly, it is not impossible.

If Religions Were True They Wouldn't Need Dogma.

Because I said so!

Why do religions require dogmas (or should that be dogmata)? Why can't they do what science does and use evidence?

Dogma is the official system of belief or doctrine held by a religion, or a particular group or organization. It serves as part of the primary basis of an ideology or belief system, and it cannot be changed or discarded without affecting the very system's paradigm, or the ideology itself. They can refer to acceptable opinions of philosophers or philosophical schools, public decrees, or issued decisions of political authorities.

In religion:
Dogmata are found in religions such as Christianity, Judaism, and Islam, where they are considered core principles that must be upheld by all believers of that religion. As a fundamental element of religion, the term "dogma" is assigned to those theological tenets which are considered to be well demonstrated, such that their proposed disputation or revision effectively means that a person no longer accepts the given religion as his or her own, or has entered into a period of personal doubt. Dogma is distinguished from theological opinion regarding those things considered less well-known. Dogmata may be clarified and elaborated but not contradicted in novel teachings (e.g., Galatians 1:6-9). Rejection of dogma may lead to expulsion from a religious group.

Wipedia - Dogma.

Evolution of a Strange Pair of Geese

Left: hybrid Graylag goose, Anser anser
and Canada goose, Branta canadensis

Right: Graylag goose, Anser answer

The thing about knowing you don't know all the answers, but also knowing that nature is amenable to reason, is that when you see something that makes you curious, you know you will probably find the answer if you look hard enough. With nature, that answer will be interesting, thought-provoking and will mean you will understand nature just a little better.

We saw these two wild geese on on lake near Oxford the other day when we went for a long country walk with our grandson and his parents. My grandson would much rather talk about Minecraft and wasn't even interested when I showed him the hole where the little gall wasp came out of an oak-apple gall - how can that not be interesting? He'll soon be old enough to have that copy of Richard Dawkins' "The Magic Of Reality" I bought him when he was about 4.

Anyway, what we noticed about these geese was that, while they are obviously a pair and the one on the right is a perfectly normal-looking graylag goose, the other was a slightly odd-looking Canada goose. Canada geese are an alien species in Britain but have spread very rapidly throughout the Thames Valley and beyond.

Creationism in Crisis - Yes! It's That Transitional Species Again

Tiktaalik roseae (artists impression)

If Creationism ranked as a serious scientific hypothesis, it would have been abandoned years ago because of the mass of evidence for an alternative theory - the Theory of Evolution. In fact, of course, in scientific circles, Creationism was never regarded as serious science because it entailed magical entities and was unfalsifiable, and was abandoned in 1859 when Darwin & Wallace first published their explanation for biodiversity and the existence of species.

Yet the childish superstition persists in the more backward and scientifically illiterate parts of the world, despite evidence of so many transitional species showing a clear evolutionary change from an earlier taxon to a later one. One such transition that has evidence in the fossil record is the evolutionary transition from lobe-finned fish to terrestrial vertebrates.

A key stage in the development of the terrestrial vertebrates was the transition onto land of air-breathing fish, so a key piece of conditioned denialism for Creationists is to claim there are no fossils showing this transition because their dogma dictates that there are no transitional fossils, for no better reason than Darwin said there should be some.

In fact, of course, there are very many of these fossils showing intermediate species, capable of crawling out onto land and of living in water.

I described this transition, and the ecological changes that facilitated it, in my book, What Makes You So Special: From the Big Bang to You, which deals with the science behind the formation of the Universe, of Earth and of life on Earth, and eventually to humans and the development of human cultures and civilisations, culminating ultimately in you, as a unique individual and beneficiary of that immense chain of causality. So, it's good to know this subject has now been made into a YouTube video, which entirely vindicates what I said:

Now, here is my description: